Transcript: Human NM_001130847.3

Homo sapiens apoptosis inducing factor mitochondria associated 1 (AIFM1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
AIFM1 (9131)
Length:
2492
CDS:
232..1206

Additional Resources:

NCBI RefSeq record:
NM_001130847.3
NBCI Gene record:
AIFM1 (9131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218045 AGATTTCACGGGAAGTCAAAT pLKO_005 1115 CDS 100% 13.200 18.480 N AIFM1 n/a
2 TRCN0000229860 TTTGGTGGCTTCCGGGTAAAT pLKO_005 1686 3UTR 100% 13.200 18.480 N AIFM1 n/a
3 TRCN0000229861 CTGCATGCTTCTACGATATAA pLKO_005 1750 3UTR 100% 15.000 12.000 N AIFM1 n/a
4 TRCN0000218610 CATGTTCCTTTCCTGCTAATT pLKO_005 622 CDS 100% 13.200 9.240 N AIFM1 n/a
5 TRCN0000064490 CCTGGAAATAGACTCAGATTT pLKO.1 1667 3UTR 100% 13.200 9.240 N AIFM1 n/a
6 TRCN0000229862 CCCACAGTGGAATTGGCAAAC pLKO_005 2280 3UTR 100% 6.000 4.200 N AIFM1 n/a
7 TRCN0000064489 GCCAAACTATTCAACATTCAT pLKO.1 2247 3UTR 100% 5.625 3.938 N AIFM1 n/a
8 TRCN0000064488 GCTCTCAAATAACCTATGAAA pLKO.1 974 CDS 100% 5.625 3.938 N AIFM1 n/a
9 TRCN0000064491 CTGCGATTCAAACAGTGGAAT pLKO.1 802 CDS 100% 4.950 3.465 N AIFM1 n/a
10 TRCN0000064492 CCGAGAAAGGAAATATGGGAA pLKO.1 1438 3UTR 100% 2.640 1.848 N AIFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02089 pDONR223 100% 52.6% 52.5% None 968A>C;970_971delATinsCG;972_973ins867 n/a
2 ccsbBroad304_02089 pLX_304 0% 52.6% 52.5% V5 968A>C;970_971delATinsCG;972_973ins867 n/a
3 TRCN0000467646 TACCGAATAATTTATATCCCACTC pLX_317 23.2% 52.6% 52.5% V5 968A>C;970_971delATinsCG;972_973ins867 n/a
4 ccsbBroadEn_07363 pDONR223 100% 48.6% 47.7% None (many diffs) n/a
Download CSV