Transcript: Human NM_001134486.3

Homo sapiens guanylate binding protein 5 (GBP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GBP5 (115362)
Length:
3943
CDS:
429..2189

Additional Resources:

NCBI RefSeq record:
NM_001134486.3
NBCI Gene record:
GBP5 (115362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159924 CAAGGTAGTGATCAAAGAGTT pLKO.1 1050 CDS 100% 4.950 3.465 N GBP5 n/a
2 TRCN0000161021 GCTCGGCTTTACTTAAGGATA pLKO.1 1642 CDS 100% 4.950 3.465 N GBP5 n/a
3 TRCN0000162498 CAAGTGAAAGCAGAAGCTGAA pLKO.1 1899 CDS 100% 4.050 2.835 N GBP5 n/a
4 TRCN0000164503 CGGAAAGGAATACAGGCTGAA pLKO.1 1776 CDS 100% 4.050 2.835 N GBP5 n/a
5 TRCN0000163742 GATGATGAGCTAGAGCCTGAA pLKO.1 1185 CDS 100% 4.050 2.835 N GBP5 n/a
6 TRCN0000158813 GCCATAATCTCTTCATTCAGA pLKO.1 1717 CDS 100% 3.000 2.100 N GBP5 n/a
7 TRCN0000162047 CCGTCTGTGTATACAGAAGTT pLKO.1 1088 CDS 100% 0.495 0.347 N GBP5 n/a
8 TRCN0000148294 CCTGAATTTGTGCAACAAGTA pLKO.1 1200 CDS 100% 4.950 2.475 Y GBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04681 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04681 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473911 GTATTTGGAGCGGAGATCCTATTA pLX_317 26.5% 100% 100% V5 n/a
Download CSV