Transcript: Human NM_001134647.1

Homo sapiens actin filament associated protein 1 (AFAP1), transcript variant A, mRNA.

Source:
NCBI, updated 2019-06-27
Taxon:
Homo sapiens (human)
Gene:
AFAP1 (60312)
Length:
7786
CDS:
274..2718

Additional Resources:

NCBI RefSeq record:
NM_001134647.1
NBCI Gene record:
AFAP1 (60312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151459 CCGGAATACATCACATCAAAT pLKO.1 589 CDS 100% 13.200 18.480 N AFAP1 n/a
2 TRCN0000154058 CCGGGTTTGGATTCTAAACAT pLKO.1 1468 CDS 100% 5.625 7.875 N AFAP1 n/a
3 TRCN0000153932 CCAAGGCTGTAACATTACGTA pLKO.1 867 CDS 100% 3.000 2.400 N AFAP1 n/a
4 TRCN0000153097 GAACTCCTGGACCATGAATAT pLKO.1 310 CDS 100% 13.200 9.240 N AFAP1 n/a
5 TRCN0000153468 CAGGCGTGTTATATCTGCTAA pLKO.1 1695 CDS 100% 4.950 3.465 N AFAP1 n/a
6 TRCN0000151277 CCAGAAGGTTATTATGAGGAA pLKO.1 541 CDS 100% 2.640 1.848 N AFAP1 n/a
7 TRCN0000152452 CCCAGAAGGTTATTATGAGGA pLKO.1 540 CDS 100% 2.640 1.848 N AFAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08789 pDONR223 100% 89.5% 89.4% None (many diffs) n/a
2 ccsbBroad304_08789 pLX_304 0% 89.5% 89.4% V5 (many diffs) n/a
3 TRCN0000469880 TCAGTTATAAATAGTTGCAGCACG pLX_317 19.8% 89.5% 89.4% V5 (many diffs) n/a
Download CSV