Transcript: Human NM_001135000.2

Homo sapiens fermitin family member 2 (FERMT2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
FERMT2 (10979)
Length:
2296
CDS:
140..2041

Additional Resources:

NCBI RefSeq record:
NM_001135000.2
NBCI Gene record:
FERMT2 (10979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330301 GTAGCTCAGATGAGTCTAATT pLKO_005 1796 CDS 100% 13.200 18.480 N FERMT2 n/a
2 TRCN0000330300 AGCAGATCACGACTGATATAA pLKO_005 1668 CDS 100% 15.000 10.500 N FERMT2 n/a
3 TRCN0000128511 CCGAAGAACTTTCTCTCTTAA pLKO.1 543 CDS 100% 13.200 9.240 N FERMT2 n/a
4 TRCN0000128058 GCGGACAGTTCTTACAACTTA pLKO.1 1580 CDS 100% 5.625 3.938 N FERMT2 n/a
5 TRCN0000330230 GCGGACAGTTCTTACAACTTA pLKO_005 1580 CDS 100% 5.625 3.938 N FERMT2 n/a
6 TRCN0000129672 CGACTGATATAACTCCTGAAT pLKO.1 1677 CDS 100% 4.950 3.465 N FERMT2 n/a
7 TRCN0000330302 CAGCACTGGAGATGCAATTAA pLKO_005 1954 CDS 100% 15.000 9.000 N FERMT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07718 pDONR223 100% 90.8% 90.8% None (many diffs) n/a
2 ccsbBroad304_07718 pLX_304 0% 90.8% 90.8% V5 (many diffs) n/a
3 TRCN0000468260 TCCGCGATCCCTGGATCACATGCA pLX_317 13% 90.8% 90.8% V5 (many diffs) n/a
Download CSV