Transcript: Human NM_001135190.1

Homo sapiens ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (ARAP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ARAP1 (116985)
Length:
4750
CDS:
736..4137

Additional Resources:

NCBI RefSeq record:
NM_001135190.1
NBCI Gene record:
ARAP1 (116985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047836 CCGCAGGGATCTTACATCTAT pLKO.1 1015 CDS 100% 5.625 7.875 N ARAP1 n/a
2 TRCN0000047837 CGATCGCTACTTCATCCTCAA pLKO.1 3717 CDS 100% 4.050 5.670 N ARAP1 n/a
3 TRCN0000047833 CCTGCGATACTTTGACAGTAA pLKO.1 1068 CDS 100% 4.950 3.960 N ARAP1 n/a
4 TRCN0000428992 CATGAGTGGGTCAAGTGTATT pLKO_005 2332 CDS 100% 13.200 9.240 N ARAP1 n/a
5 TRCN0000433585 ACTTCATCTGCACAGTGTATC pLKO_005 3335 CDS 100% 10.800 7.560 N ARAP1 n/a
6 TRCN0000438499 GAGAACGGCTGTACCTGTTTG pLKO_005 2288 CDS 100% 10.800 7.560 N ARAP1 n/a
7 TRCN0000438169 GCTGGAGAGATGGGCATAAGT pLKO_005 4414 3UTR 100% 5.625 3.938 N ARAP1 n/a
8 TRCN0000047834 CATGGCTTTGAGCACACCTTT pLKO.1 2251 CDS 100% 4.950 3.465 N ARAP1 n/a
9 TRCN0000047835 GTGGCCTATTAAGAGTCTCAA pLKO.1 3792 CDS 100% 4.950 3.465 N ARAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09439 pDONR223 100% 99.9% 99.9% None 181C>T;1857G>A n/a
2 ccsbBroad304_09439 pLX_304 0% 99.9% 99.9% V5 181C>T;1857G>A n/a
3 TRCN0000480589 AAATAACGGCTCGCGCACATTAAT pLX_317 10.6% 99.9% 99.9% V5 181C>T;1857G>A n/a
Download CSV