Transcript: Human NM_001135212.2

Homo sapiens FKBP prolyl isomerase 7 (FKBP7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
FKBP7 (51661)
Length:
2873
CDS:
102..767

Additional Resources:

NCBI RefSeq record:
NM_001135212.2
NBCI Gene record:
FKBP7 (51661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054000 GCTCTCTAAAGCCGAGATAAA pLKO.1 590 CDS 100% 13.200 18.480 N FKBP7 n/a
2 TRCN0000054002 CCACCGGATGCTACATTGATT pLKO.1 486 CDS 100% 5.625 7.875 N FKBP7 n/a
3 TRCN0000053998 CCCTTCATTTGCATACGGAAA pLKO.1 443 CDS 100% 4.050 5.670 N FKBP7 n/a
4 TRCN0000054001 CCACGGAGCATTGAGACATTT pLKO.1 540 CDS 100% 13.200 10.560 N FKBP7 n/a
5 TRCN0000053999 GCTTCATTTCTCCCAAGGAAT pLKO.1 718 CDS 100% 4.950 3.465 N FKBP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03359 pDONR223 100% 99.5% 99.5% None 372_373insGCA n/a
2 ccsbBroad304_03359 pLX_304 0% 99.5% 99.5% V5 372_373insGCA n/a
3 TRCN0000474688 CACACAATAATACTTGCGAGTAAT pLX_317 25.5% 99.5% 99.5% V5 372_373insGCA n/a
Download CSV