Construct: ORF TRCN0000474688
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007994.1_s317c1
- Derived from:
- ccsbBroadEn_03359
- DNA Barcode:
- CACACAATAATACTTGCGAGTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FKBP7 (51661)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474688
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51661 | FKBP7 | FKBP prolyl isomerase 7 | NM_181342.3 | 100% | 100% | |
| 2 | human | 51661 | FKBP7 | FKBP prolyl isomerase 7 | NM_001135212.2 | 99.5% | 99.5% | 372_373insGCA |
| 3 | human | 51661 | FKBP7 | FKBP prolyl isomerase 7 | XM_011511348.3 | 51.8% | 44% | 0_1ins169;51_52ins152 |
| 4 | human | 51661 | FKBP7 | FKBP prolyl isomerase 7 | XM_011511349.3 | 51.3% | 44.1% | 0_1ins169;47_48ins155 |
| 5 | human | 51661 | FKBP7 | FKBP prolyl isomerase 7 | XM_005246638.5 | 49.2% | 45.8% | 1_144del;516_517ins134;543_544ins133 |
| 6 | mouse | 14231 | Fkbp7 | FK506 binding protein 7 | NM_010222.2 | 83.7% | 85.5% | (many diffs) |
| 7 | mouse | 14231 | Fkbp7 | FK506 binding protein 7 | XM_006498749.2 | 83.2% | 85.1% | (many diffs) |
| 8 | mouse | 14231 | Fkbp7 | FK506 binding protein 7 | XR_374406.3 | 44% | (many diffs) | |
| 9 | mouse | 14231 | Fkbp7 | FK506 binding protein 7 | XR_374407.3 | 43.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc aaaaaccatg catttcttat tcagattcat tgttttcttt tatctgtggg 121 gcctttttac tgctcagaga caaaagaaag aggagagcac cgaagaagtg aaaatagaag 181 ttttgcatcg tccagaaaac tgctctaaga caagcaagaa gggagaccta ctaaatgccc 241 attatgacgg ctacctggct aaagacggct cgaaattcta ctgcagccgg acacaaaatg 301 aaggccaccc caaatggttt gttcttggtg ttgggcaagt cataaaaggc ctagacattg 361 ctatgacaga tatgtgccct ggagaaaagc gaaaagtagt tataccccct tcatttgcat 421 acggaaagga aggctatgca gaaggcaaga ttccaccgga tgctacattg atttttgaga 481 ttgaacttta tgctgtgacc aaaggaccac ggagcattga gacatttaaa caaatagaca 541 tggacaatga caggcagctc tctaaagCCG AGATAAACCT CTACTTGCAA AGGGAATTTG 601 AAAAAGATGA GAAGCCACGT GACAAGTCAT ATCAGGATGC AGTTTTAGAA GATATTTTTA 661 AGAAGAATGA CCATGATGGT GATGGCTTCA TTTCTCCCAA GGAATACAAT GTATACCAAC 721 ACGATGAACT ATACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 781 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 841 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACAC ACAATAATAC TTGCGAGTAA 901 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t