Transcript: Mouse NM_001135559.1

Mus musculus son of sevenless homolog 2 (Drosophila) (Sos2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sos2 (20663)
Length:
5612
CDS:
252..4250

Additional Resources:

NCBI RefSeq record:
NM_001135559.1
NBCI Gene record:
Sos2 (20663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001135559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076953 GCCAGTATAAAGACTCTGTAT pLKO.1 4654 3UTR 100% 4.950 3.960 N Sos2 n/a
2 TRCN0000332792 GCCAGTATAAAGACTCTGTAT pLKO_005 4654 3UTR 100% 4.950 3.960 N Sos2 n/a
3 TRCN0000076957 GCAAATGGAATAAGCCATAAT pLKO.1 2478 CDS 100% 13.200 9.240 N Sos2 n/a
4 TRCN0000332793 GCAAATGGAATAAGCCATAAT pLKO_005 2478 CDS 100% 13.200 9.240 N Sos2 n/a
5 TRCN0000076954 GCTCAGCAGAATAGTAGAAAT pLKO.1 2798 CDS 100% 13.200 9.240 N Sos2 n/a
6 TRCN0000332871 GCTCAGCAGAATAGTAGAAAT pLKO_005 2798 CDS 100% 13.200 9.240 N Sos2 n/a
7 TRCN0000076956 GCTGCCACCAAAGACTTACAA pLKO.1 4163 CDS 100% 5.625 3.938 N Sos2 n/a
8 TRCN0000332794 GCTGCCACCAAAGACTTACAA pLKO_005 4163 CDS 100% 5.625 3.938 N Sos2 n/a
9 TRCN0000076955 CCCTCTACATTGTGGCTGTAT pLKO.1 631 CDS 100% 4.950 3.465 N Sos2 n/a
10 TRCN0000332791 CCCTCTACATTGTGGCTGTAT pLKO_005 631 CDS 100% 4.950 3.465 N Sos2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01578 pDONR223 100% 88.5% 94.8% None (many diffs) n/a
2 ccsbBroad304_01578 pLX_304 0% 88.5% 94.8% V5 (many diffs) n/a
Download CSV