Transcript: Human NM_001135662.2

Homo sapiens RAB29, member RAS oncogene family (RAB29), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RAB29 (8934)
Length:
3207
CDS:
240..851

Additional Resources:

NCBI RefSeq record:
NM_001135662.2
NBCI Gene record:
RAB29 (8934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303685 AGTGGTCTGACTACGAGATAG pLKO_005 388 CDS 100% 10.800 15.120 N RAB29 n/a
2 TRCN0000379799 GGACTACATCAATCTACAAAC pLKO_005 803 CDS 100% 10.800 15.120 N RAB29 n/a
3 TRCN0000047721 CTTCACCTCTATGACACGATT pLKO.1 446 CDS 100% 4.950 6.930 N RAB29 n/a
4 TRCN0000047720 CGTTACCAATGCCACTACCTT pLKO.1 506 CDS 100% 3.000 4.200 N RAB29 n/a
5 TRCN0000047722 CGGTTCAGTAAAGAGAACGGT pLKO.1 660 CDS 100% 0.750 1.050 N RAB29 n/a
6 TRCN0000303622 CTAGTAGTGTTTGGCTTATTT pLKO_005 848 CDS 100% 0.000 0.000 N RAB29 n/a
7 TRCN0000303623 ATGCCTCTGCCTGTGTTATTA pLKO_005 478 CDS 100% 15.000 10.500 N RAB29 n/a
8 TRCN0000303621 AGTTAGTGCCTTCGGTGTAAG pLKO_005 1070 3UTR 100% 10.800 7.560 N RAB29 n/a
9 TRCN0000381042 GCAAGCTCACACTACCCAATG pLKO_005 562 CDS 100% 6.000 4.200 N RAB29 n/a
10 TRCN0000047718 CCACAGAAGATATCATGTCTT pLKO.1 769 CDS 100% 4.950 3.465 N RAB29 n/a
11 TRCN0000299449 CCACAGAAGATATCATGTCTT pLKO_005 769 CDS 100% 4.950 3.465 N RAB29 n/a
12 TRCN0000382067 TTGACGTTACCAATGCCACTA pLKO_005 502 CDS 100% 4.050 2.835 N RAB29 n/a
13 TRCN0000047719 GCTATGAGAGTCCTCATTGAA pLKO.1 732 CDS 100% 0.563 0.394 N RAB29 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2378 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2378 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2376 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2376 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2376 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2546 3UTR 100% 4.950 2.475 Y DCAF11 n/a
20 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1485 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02050 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02050 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467837 CAGATACGCTTGTAGGTTTTACTC pLX_317 67.4% 100% 100% V5 n/a
Download CSV