Transcript: Human NM_001135685.2

Homo sapiens leukocyte receptor tyrosine kinase (LTK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LTK (4058)
Length:
2682
CDS:
119..2323

Additional Resources:

NCBI RefSeq record:
NM_001135685.2
NBCI Gene record:
LTK (4058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148067 AGCACGTACCCGGAAAACGT pXPR_003 AGG 649 29% 5 1.0065 LTK LTK 77598
2 BRDN0001146840 CTCACCCGGAGAATTCAGCG pXPR_003 GGG 175 8% 2 -0.0734 LTK LTK 77599
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003157 CTTTGGGATGGCACGAGATAT pLKO.1 1720 CDS 100% 13.200 18.480 N LTK n/a
2 TRCN0000235412 TTTGGGATGGCACGAGATATC pLKO_005 1721 CDS 100% 10.800 15.120 N LTK n/a
3 TRCN0000197029 GATCTTTGGAGTGCCTAAGAC pLKO.1 2157 CDS 100% 4.950 6.930 N LTK n/a
4 TRCN0000003156 CGTCTTCGTCTCAGCAATCTT pLKO.1 541 CDS 100% 5.625 4.500 N LTK n/a
5 TRCN0000235411 CACTTCATCCACAGGGATATT pLKO_005 1640 CDS 100% 13.200 9.240 N LTK n/a
6 TRCN0000235414 AGTTTCGCCATCAGAACATTG pLKO_005 1428 CDS 100% 10.800 7.560 N LTK n/a
7 TRCN0000380148 CTCAACACTGAGCCTCCTTAT pLKO_005 1237 CDS 100% 10.800 7.560 N LTK n/a
8 TRCN0000380588 TCTTCGTCTCAGCAATCTTCT pLKO_005 543 CDS 100% 4.950 3.465 N LTK n/a
9 TRCN0000235413 ACTGAGGGTCCCTCCCTATAC pLKO_005 2357 3UTR 100% 3.600 2.520 N LTK n/a
10 TRCN0000003154 GCCAATGTTACTCTGCTCAGA pLKO.1 1341 CDS 100% 2.640 1.848 N LTK n/a
11 TRCN0000199095 CTTGCCATGCTGGAAACCAGC pLKO.1 2479 3UTR 100% 0.720 0.504 N LTK n/a
12 TRCN0000003155 GATCTTCTCACTGGGCTACAT pLKO.1 1873 CDS 100% 4.950 2.970 N LTK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488085 GATTCACTGCCTCCTGAAGAAAGG pLX_317 25.5% 47.6% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV