Transcript: Human NM_001135753.1

Homo sapiens ecdysoneless cell cycle regulator (ECD), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ECD (11319)
Length:
2151
CDS:
244..2049

Additional Resources:

NCBI RefSeq record:
NM_001135753.1
NBCI Gene record:
ECD (11319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016031 CCCAGACTACCGATAACAATT pLKO.1 1829 CDS 100% 13.200 18.480 N ECD n/a
2 TRCN0000318856 CCCAGACTACCGATAACAATT pLKO_005 1829 CDS 100% 13.200 18.480 N ECD n/a
3 TRCN0000086602 CTCCAAATGTAGCCCACATTT pLKO.1 1050 CDS 100% 1.320 1.056 N Ecd n/a
4 TRCN0000086600 GCTCCAAATGTAGCCCACATT pLKO.1 1049 CDS 100% 0.495 0.396 N Ecd n/a
5 TRCN0000416609 ATTGAGGATGAATGGTTTATT pLKO_005 496 CDS 100% 15.000 10.500 N Ecd n/a
6 TRCN0000274297 CTTGCCTGAAACACGAATAAT pLKO_005 999 CDS 100% 15.000 10.500 N ECD n/a
7 TRCN0000274356 CTCATGGATTTGAGATCTTAT pLKO_005 1028 CDS 100% 13.200 9.240 N ECD n/a
8 TRCN0000274355 GAATCAGCCTTTCAATCTTAA pLKO_005 411 CDS 100% 13.200 9.240 N ECD n/a
9 TRCN0000016029 CCAGAGTTAGTAGCAAGGATT pLKO.1 550 CDS 100% 4.950 3.465 N ECD n/a
10 TRCN0000274358 CCAGAGTTAGTAGCAAGGATT pLKO_005 550 CDS 100% 4.950 3.465 N ECD n/a
11 TRCN0000016030 CCCAACAATTCCACAAGCATT pLKO.1 735 CDS 100% 4.950 3.465 N ECD n/a
12 TRCN0000016032 CCATTTGATATAGAAGACCTT pLKO.1 1294 CDS 100% 2.640 1.848 N ECD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02671 pDONR223 100% 93.3% 93.3% None 782_783ins129 n/a
2 ccsbBroad304_02671 pLX_304 0% 93.3% 93.3% V5 782_783ins129 n/a
3 TRCN0000470911 ATCCGACAGTATGCGCCCTAGTGA pLX_317 17.4% 93.3% 93.3% V5 782_783ins129 n/a
Download CSV