Transcript: Human NM_001136134.1

Homo sapiens ribosomal protein L28 (RPL28), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RPL28 (6158)
Length:
4439
CDS:
43..534

Additional Resources:

NCBI RefSeq record:
NM_001136134.1
NBCI Gene record:
RPL28 (6158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117677 CCCGTGTTTGTGAATATCATT pLKO.1 4272 3UTR 100% 5.625 7.875 N RPL28 n/a
2 TRCN0000441797 CAAAGGTGTCGTGGTGGTCAT pLKO_005 213 CDS 100% 4.050 5.670 N RPL28 n/a
3 TRCN0000117680 TGGTGGTCATTAAGCGGAGAT pLKO.1 224 CDS 100% 4.050 5.670 N RPL28 n/a
4 TRCN0000117681 CTACAGCACTGAGCCCAATAA pLKO.1 114 CDS 100% 13.200 10.560 N RPL28 n/a
5 TRCN0000443209 TGGCCCTGTGTGTTGTCATTC pLKO_005 737 3UTR 100% 10.800 7.560 N RPL28 n/a
6 TRCN0000415663 CATTCAGGCCATGTCATCAAA pLKO_005 753 3UTR 100% 5.625 3.938 N RPL28 n/a
7 TRCN0000117678 CGGACCACCATCAACAAGAAT pLKO.1 277 CDS 100% 5.625 3.938 N RPL28 n/a
8 TRCN0000117679 CCGCAATTCCTTCCGCTACAA pLKO.1 144 CDS 100% 4.950 3.465 N RPL28 n/a
9 TRCN0000444571 GGACTGATTCACCGCAAGACT pLKO_005 166 CDS 100% 3.000 2.100 N RPL28 n/a
10 TRCN0000431860 AGGAATAAGCAGACCTACAGC pLKO_005 100 CDS 100% 2.640 1.848 N RPL28 n/a
11 TRCN0000431518 TTGCTGACTTGTGATTGAGAC pLKO_005 891 3UTR 100% 4.050 2.430 N RPL28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01432 pDONR223 100% 75.8% 65.6% None (many diffs) n/a
2 ccsbBroad304_01432 pLX_304 0% 75.8% 65.6% V5 (many diffs) n/a
3 TRCN0000471204 CGAAAGAAACAAATAACCACCTCA pLX_317 100% 75.8% 65.6% V5 (many diffs) n/a
4 ccsbBroadEn_06885 pDONR223 100% 75.6% 65.1% None (many diffs) n/a
5 ccsbBroad304_06885 pLX_304 0% 75.6% 65.1% V5 (many diffs) n/a
6 TRCN0000468159 CACGAACTCGTGCGTGTGCCACAA pLX_317 81.2% 75.6% 65.1% V5 (many diffs) n/a
Download CSV