Transcript: Human NM_001136136.1

Homo sapiens ribosomal protein L28 (RPL28), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
RPL28 (6158)
Length:
594
CDS:
43..306

Additional Resources:

NCBI RefSeq record:
NM_001136136.1
NBCI Gene record:
RPL28 (6158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441797 CAAAGGTGTCGTGGTGGTCAT pLKO_005 213 CDS 100% 4.050 5.670 N RPL28 n/a
2 TRCN0000117680 TGGTGGTCATTAAGCGGAGAT pLKO.1 224 CDS 100% 4.050 5.670 N RPL28 n/a
3 TRCN0000117681 CTACAGCACTGAGCCCAATAA pLKO.1 114 CDS 100% 13.200 10.560 N RPL28 n/a
4 TRCN0000117679 CCGCAATTCCTTCCGCTACAA pLKO.1 144 CDS 100% 4.950 3.465 N RPL28 n/a
5 TRCN0000444571 GGACTGATTCACCGCAAGACT pLKO_005 166 CDS 100% 3.000 2.100 N RPL28 n/a
6 TRCN0000431860 AGGAATAAGCAGACCTACAGC pLKO_005 100 CDS 100% 2.640 1.848 N RPL28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01432 pDONR223 100% 52.6% 50.3% None (many diffs) n/a
2 ccsbBroad304_01432 pLX_304 0% 52.6% 50.3% V5 (many diffs) n/a
3 TRCN0000471204 CGAAAGAAACAAATAACCACCTCA pLX_317 100% 52.6% 50.3% V5 (many diffs) n/a
4 ccsbBroadEn_06885 pDONR223 100% 52.6% 50.3% None (many diffs) n/a
5 ccsbBroad304_06885 pLX_304 0% 52.6% 50.3% V5 (many diffs) n/a
6 TRCN0000468159 CACGAACTCGTGCGTGTGCCACAA pLX_317 81.2% 52.6% 50.3% V5 (many diffs) n/a
Download CSV