Transcript: Human NM_001136195.2

Homo sapiens transportin 2 (TNPO2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
TNPO2 (30000)
Length:
5021
CDS:
295..2958

Additional Resources:

NCBI RefSeq record:
NM_001136195.2
NBCI Gene record:
TNPO2 (30000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424939 GGCGTTGTGCAGGACTTTATT pLKO_005 2764 CDS 100% 15.000 21.000 N TNPO2 n/a
2 TRCN0000422511 GGGATGAAGTACTCGGAAATT pLKO_005 1207 CDS 100% 13.200 18.480 N TNPO2 n/a
3 TRCN0000043468 CCTGCTTAACTCGGAGGATTA pLKO.1 693 CDS 100% 10.800 15.120 N TNPO2 n/a
4 TRCN0000445037 GATCCAGTGCCTGTCGGATAA pLKO_005 1614 CDS 100% 10.800 15.120 N TNPO2 n/a
5 TRCN0000428330 TGCTCTGTCCGACTGGAATTT pLKO_005 1389 CDS 100% 13.200 10.560 N TNPO2 n/a
6 TRCN0000070167 GCACAGCATCATCCAGTACAT pLKO.1 1050 CDS 100% 4.950 3.465 N Tnpo2 n/a
7 TRCN0000324597 GCACAGCATCATCCAGTACAT pLKO_005 1050 CDS 100% 4.950 3.465 N Tnpo2 n/a
8 TRCN0000043472 CCTTGTCTTTGCCTTTGGGAA pLKO.1 1860 CDS 100% 2.640 1.848 N TNPO2 n/a
9 TRCN0000423653 AGGAGTGAGTGGGACTCAAAT pLKO_005 3065 3UTR 100% 13.200 7.920 N TNPO2 n/a
10 TRCN0000043470 CCTGTGGCAGACTTCATCAAA pLKO.1 544 CDS 100% 5.625 3.375 N TNPO2 n/a
11 TRCN0000043471 CCTGGGCCATTGGTGAAATTT pLKO.1 2471 CDS 100% 15.000 10.500 N TNPO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466052 CCCAGCGAGCTATTGCCCAGAAGA pLX_317 10.4% 100% 100% V5 n/a
2 ccsbBroadEn_08158 pDONR223 100% 99.9% 99.8% None 2618T>N n/a
3 ccsbBroad304_08158 pLX_304 0% 99.9% 99.8% V5 2618T>N n/a
Download CSV