Transcript: Mouse NM_001136227.1

Mus musculus rhotekin (Rtkn), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rtkn (20166)
Length:
2202
CDS:
142..1836

Additional Resources:

NCBI RefSeq record:
NM_001136227.1
NBCI Gene record:
Rtkn (20166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001136227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322093 TGGTGTGCAACAGCCGTATTC pLKO_005 368 CDS 100% 10.800 15.120 N Rtkn n/a
2 TRCN0000322094 CTCTTAAGTTGTGGCTATCAT pLKO_005 1989 3UTR 100% 5.625 4.500 N Rtkn n/a
3 TRCN0000180783 GCACTGTTGTGATGAAGTCAT pLKO.1 1407 CDS 100% 4.950 3.960 N Rtkn n/a
4 TRCN0000322030 GTGGAAGGATACAGAGTATTT pLKO_005 534 CDS 100% 13.200 9.240 N Rtkn n/a
5 TRCN0000322028 CAAGAACCACTGTTCACTATC pLKO_005 1195 CDS 100% 10.800 7.560 N Rtkn n/a
6 TRCN0000180190 CTCAGCATCAGCAACAAGTAT pLKO.1 1282 CDS 100% 5.625 3.938 N Rtkn n/a
7 TRCN0000181058 CAAGATGGATTCCGTACACAT pLKO.1 949 CDS 100% 4.950 3.465 N Rtkn n/a
8 TRCN0000184056 CAGCCGTATTCTCAGCTACAT pLKO.1 378 CDS 100% 4.950 3.465 N Rtkn n/a
9 TRCN0000219580 CACCCTGGCTAGCAATGTTTA pLKO.1 1580 CDS 100% 13.200 7.920 N Rtkn n/a
10 TRCN0000322092 CACCCTGGCTAGCAATGTTTA pLKO_005 1580 CDS 100% 13.200 7.920 N Rtkn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01468 pDONR223 100% 87.5% 86.7% None (many diffs) n/a
2 TRCN0000467114 ATCCATATCAAGTGAAAACGTATG pLX_317 21.7% 87.5% 86.7% V5 (many diffs) n/a
3 ccsbBroadEn_01467 pDONR223 100% 84.6% 82.1% None (many diffs) n/a
4 ccsbBroad304_01467 pLX_304 0% 84.6% 82.1% V5 (many diffs) n/a
5 TRCN0000473458 TCGCGGGCTACTGGTCGATTCCGG pLX_317 31.9% 84.6% 82.1% V5 (many diffs) n/a
Download CSV