Transcript: Human NM_001136530.1

Homo sapiens serpin family E member 2 (SERPINE2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SERPINE2 (5270)
Length:
2186
CDS:
138..1367

Additional Resources:

NCBI RefSeq record:
NM_001136530.1
NBCI Gene record:
SERPINE2 (5270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052315 CCTCGTCAACGCAGTGTATTT pLKO.1 719 CDS 100% 13.200 18.480 N SERPINE2 n/a
2 TRCN0000290150 CCTCGTCAACGCAGTGTATTT pLKO_005 719 CDS 100% 13.200 18.480 N SERPINE2 n/a
3 TRCN0000052313 CGGCGTAAATGGAGTTGGTAA pLKO.1 422 CDS 100% 4.950 6.930 N SERPINE2 n/a
4 TRCN0000290223 CGGCGTAAATGGAGTTGGTAA pLKO_005 422 CDS 100% 4.950 6.930 N SERPINE2 n/a
5 TRCN0000052316 GAACACAAAGAAACGCACTTT pLKO.1 773 CDS 100% 4.950 3.465 N SERPINE2 n/a
6 TRCN0000290224 GAACACAAAGAAACGCACTTT pLKO_005 773 CDS 100% 4.950 3.465 N SERPINE2 n/a
7 TRCN0000052317 GTTTATAGTAGACAGACCTTT pLKO.1 1280 CDS 100% 4.950 3.465 N SERPINE2 n/a
8 TRCN0000290152 GTTTATAGTAGACAGACCTTT pLKO_005 1280 CDS 100% 4.950 3.465 N SERPINE2 n/a
9 TRCN0000052314 GTTTGATTCATCAAAGGCAAA pLKO.1 1121 CDS 100% 0.405 0.284 N SERPINE2 n/a
10 TRCN0000290226 GTTTGATTCATCAAAGGCAAA pLKO_005 1121 CDS 100% 0.405 0.284 N SERPINE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01194 pDONR223 100% 97% 97% None 1_36del n/a
2 ccsbBroad304_01194 pLX_304 0% 97% 97% V5 1_36del n/a
3 TRCN0000471223 ATCCTGAGCATCCAATCCCGTCTC pLX_317 42.3% 97% 97% V5 1_36del n/a
4 ccsbBroadEn_01193 pDONR223 100% 96.8% 96.5% None 1_36del;1021_1022insCAG n/a
5 ccsbBroad304_01193 pLX_304 0% 96.8% 96.5% V5 1_36del;1021_1022insCAG n/a
6 TRCN0000470631 ACCCAATCCCCATTTAAAGCCACT pLX_317 38.7% 96.8% 96.5% V5 1_36del;1021_1022insCAG n/a
Download CSV