Transcript: Mouse NM_001141930.1

Mus musculus catenin beta interacting protein 1 (Ctnnbip1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ctnnbip1 (67087)
Length:
2580
CDS:
144..389

Additional Resources:

NCBI RefSeq record:
NM_001141930.1
NBCI Gene record:
Ctnnbip1 (67087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001141930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095757 GCCACAGCACTCCATCGACCA pLKO.1 308 CDS 100% 0.000 0.000 N Ctnnbip1 n/a
2 TRCN0000326876 GCCACAGCACTCCATCGACCA pLKO_005 308 CDS 100% 0.000 0.000 N Ctnnbip1 n/a
3 TRCN0000095756 GAGGAATTTCTGCGCACCTAT pLKO.1 255 CDS 100% 4.950 3.960 N Ctnnbip1 n/a
4 TRCN0000326877 GAGGAATTTCTGCGCACCTAT pLKO_005 255 CDS 100% 4.950 3.960 N Ctnnbip1 n/a
5 TRCN0000095754 CCCTGTGAGATTGTATCTAAA pLKO.1 2345 3UTR 100% 13.200 9.240 N Ctnnbip1 n/a
6 TRCN0000021830 AGTCCGGAGGAGATGTACATT pLKO.1 171 CDS 100% 5.625 3.938 N CTNNBIP1 n/a
7 TRCN0000275184 AGTCCGGAGGAGATGTACATT pLKO_005 171 CDS 100% 5.625 3.938 N CTNNBIP1 n/a
8 TRCN0000095755 CCGGAGGAGATGTACATTCAA pLKO.1 174 CDS 100% 5.625 3.938 N Ctnnbip1 n/a
9 TRCN0000326878 CCGGAGGAGATGTACATTCAA pLKO_005 174 CDS 100% 5.625 3.938 N Ctnnbip1 n/a
10 TRCN0000095758 AGACGGAAGACCGGAGGCAGT pLKO.1 367 CDS 100% 0.000 0.000 N Ctnnbip1 n/a
11 TRCN0000354223 AGACGGAAGACCGGAGGCAGT pLKO_005 367 CDS 100% 0.000 0.000 N Ctnnbip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001141930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03769 pDONR223 100% 93.8% 97.5% None (many diffs) n/a
2 ccsbBroad304_03769 pLX_304 0% 93.8% 97.5% V5 (many diffs) n/a
3 TRCN0000473005 TCCCAGCTACCACTCCTAGCGACC pLX_317 100% 93.8% 97.5% V5 (many diffs) n/a
Download CSV