Transcript: Mouse NM_001141965.1

Mus musculus N(alpha)-acetyltransferase 20, NatB catalytic subunit (Naa20), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Naa20 (67877)
Length:
1167
CDS:
70..606

Additional Resources:

NCBI RefSeq record:
NM_001141965.1
NBCI Gene record:
Naa20 (67877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001141965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114567 GCGGAGAACTAATGGGTTATA pLKO.1 218 CDS 100% 13.200 18.480 N Naa20 n/a
2 TRCN0000325971 GCGGAGAACTAATGGGTTATA pLKO_005 218 CDS 100% 13.200 18.480 N Naa20 n/a
3 TRCN0000114570 GCAGTTGGGTTACAGTGTCTA pLKO.1 441 CDS 100% 4.950 6.930 N Naa20 n/a
4 TRCN0000114569 CGTAAGAGTATCCAATCAAGT pLKO.1 402 CDS 100% 4.950 3.960 N Naa20 n/a
5 TRCN0000326042 CGTAAGAGTATCCAATCAAGT pLKO_005 402 CDS 100% 4.950 3.960 N Naa20 n/a
6 TRCN0000114568 GTTCCGCTTCAACAACATTAA pLKO.1 105 CDS 100% 13.200 9.240 N Naa20 n/a
7 TRCN0000325970 GTTCCGCTTCAACAACATTAA pLKO_005 105 CDS 100% 13.200 9.240 N Naa20 n/a
8 TRCN0000035541 CCGCTTCAACAACATTAACTT pLKO.1 108 CDS 100% 5.625 3.938 N NAA20 n/a
9 TRCN0000290705 CCGCTTCAACAACATTAACTT pLKO_005 108 CDS 100% 5.625 3.938 N NAA20 n/a
10 TRCN0000035539 GCTGCTAAACTTATGGAGTTA pLKO.1 334 CDS 100% 4.950 3.465 N NAA20 n/a
11 TRCN0000290776 GCTGCTAAACTTATGGAGTTA pLKO_005 334 CDS 100% 4.950 3.465 N NAA20 n/a
12 TRCN0000114566 CCTTCCAATGAGCAATAGCAT pLKO.1 755 3UTR 100% 3.000 2.100 N Naa20 n/a
13 TRCN0000326040 CCTTCCAATGAGCAATAGCAT pLKO_005 755 3UTR 100% 3.000 2.100 N Naa20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001141965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08226 pDONR223 100% 91% 99.4% None (many diffs) n/a
2 ccsbBroad304_08226 pLX_304 0% 91% 99.4% V5 (many diffs) n/a
3 TRCN0000473227 TGATCAAAGACGGACTACTCTAAG pLX_317 91.8% 91% 99.4% V5 (many diffs) n/a
Download CSV