Transcript: Human NM_001142628.1

Homo sapiens SEC61 translocon alpha 2 subunit (SEC61A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SEC61A2 (55176)
Length:
2462
CDS:
148..1512

Additional Resources:

NCBI RefSeq record:
NM_001142628.1
NBCI Gene record:
SEC61A2 (55176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160534 CACCGAAAGATAGAGCTTTAT pLKO.1 395 CDS 100% 13.200 18.480 N SEC61A2 n/a
2 TRCN0000343139 CACCGAAAGATAGAGCTTTAT pLKO_005 395 CDS 100% 13.200 18.480 N SEC61A2 n/a
3 TRCN0000162602 CTCAGCCAAAGATGTAGCTAA pLKO.1 1236 CDS 100% 4.950 6.930 N SEC61A2 n/a
4 TRCN0000160947 GTACATCTAGTGTTGCCTGTA pLKO.1 1727 3UTR 100% 4.050 3.240 N SEC61A2 n/a
5 TRCN0000159597 GCTAGCAGTCACTATTATTTA pLKO.1 1425 CDS 100% 15.000 10.500 N SEC61A2 n/a
6 TRCN0000160211 CCATGTCGTTGTTTATATCAT pLKO.1 1158 CDS 100% 5.625 3.938 N SEC61A2 n/a
7 TRCN0000166254 CCAGATGCTGTCTGTTCGATT pLKO.1 996 CDS 100% 4.950 3.465 N SEC61A2 n/a
8 TRCN0000343072 CCAGATGCTGTCTGTTCGATT pLKO_005 996 CDS 100% 4.950 3.465 N SEC61A2 n/a
9 TRCN0000165087 GCTAAGTCTGTGTGCAGCATT pLKO.1 1659 3UTR 100% 4.950 3.465 N SEC61A2 n/a
10 TRCN0000165819 GAGCCCAGAAACTGTTTGGTA pLKO.1 422 CDS 100% 3.000 2.100 N SEC61A2 n/a
11 TRCN0000343071 GAGCCCAGAAACTGTTTGGTA pLKO_005 422 CDS 100% 3.000 2.100 N SEC61A2 n/a
12 TRCN0000164803 CTGCTGTTAGATGAGCTGCTA pLKO.1 568 CDS 100% 2.640 1.848 N SEC61A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12176 pDONR223 100% 82.9% 82.7% None (many diffs) n/a
2 ccsbBroad304_12176 pLX_304 0% 82.9% 82.7% V5 (many diffs) n/a
3 TRCN0000465248 CTGCCAGGTTTGACATAATTAATT pLX_317 30.6% 82.9% 82.7% V5 (many diffs) n/a
Download CSV