Transcript: Human NM_001142654.1

Homo sapiens prostaglandin E synthase 3 like (PTGES3L), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
PTGES3L (100885848)
Length:
1908
CDS:
347..832

Additional Resources:

NCBI RefSeq record:
NM_001142654.1
NBCI Gene record:
PTGES3L (100885848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276112 AGCGCTCTTCCCGCTCTATTA pLKO_005 564 CDS 100% 13.200 6.600 Y PTGES3L-AARSD1 n/a
2 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1686 3UTR 100% 10.800 5.400 Y MRPS16 n/a
3 TRCN0000183695 GAGATTGAGTTCTATGCCAAA pLKO.1 518 CDS 100% 4.050 2.025 Y AARSD1 n/a
4 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1686 3UTR 100% 10.800 5.400 Y CD3EAP n/a
5 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 1523 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09044 pDONR223 100% 22.9% 18.6% None (many diffs) n/a
2 ccsbBroad304_09044 pLX_304 0% 22.9% 18.6% V5 (many diffs) n/a
3 TRCN0000467834 ACAGACACAACCAACTTTGAGGAA pLX_317 28.9% 22.9% 18.6% V5 (many diffs) n/a
Download CSV