Transcript: Mouse NM_001142804.1

Mus musculus acyl-CoA synthetase short-chain family member 3 (Acss3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Acss3 (380660)
Length:
2130
CDS:
82..2130

Additional Resources:

NCBI RefSeq record:
NM_001142804.1
NBCI Gene record:
Acss3 (380660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427849 GCGATACAGTGGTCATCTATA pLKO_005 569 CDS 100% 13.200 18.480 N Acss3 n/a
2 TRCN0000423215 ATGCTATTGATCGGCACATTG pLKO_005 410 CDS 100% 10.800 15.120 N Acss3 n/a
3 TRCN0000112491 CGAAGCCTAAGGTGGTTGTTA pLKO.1 707 CDS 100% 5.625 7.875 N Acss3 n/a
4 TRCN0000431521 TTGTTGGACATTCCTATATTT pLKO_005 1100 CDS 100% 15.000 12.000 N Acss3 n/a
5 TRCN0000413214 GCAATCCACAGTCTCATATTT pLKO_005 643 CDS 100% 15.000 10.500 N Acss3 n/a
6 TRCN0000112494 GAGACCCTAGAATGGTCCAAA pLKO.1 1357 CDS 100% 4.950 3.465 N Acss3 n/a
7 TRCN0000112493 GCCTTCCACAAGTTGGTTTGT pLKO.1 363 CDS 100% 4.950 3.465 N Acss3 n/a
8 TRCN0000112492 GCATCCATTGTACATTCTCTA pLKO.1 939 CDS 100% 4.950 2.970 N Acss3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04089 pDONR223 99.3% 85.7% 90.1% None (many diffs) n/a
2 ccsbBroad304_04089 pLX_304 0% 85.7% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474580 AACCATATGTGTTGTCGACATTGC pLX_317 15.6% 85.7% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV