Transcript: Mouse NM_001142948.1

Mus musculus pogo transposable element with KRAB domain (Pogk), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pogk (71592)
Length:
7051
CDS:
68..1948

Additional Resources:

NCBI RefSeq record:
NM_001142948.1
NBCI Gene record:
Pogk (71592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232775 AGTTACCACCGTACATCATTT pLKO_005 1353 CDS 100% 13.200 18.480 N POGK n/a
2 TRCN0000095259 CGACATTGTTTAGTTCACAAA pLKO.1 2263 3UTR 100% 4.950 6.930 N Pogk n/a
3 TRCN0000095261 GCCAGATATGATCAATCGGTT pLKO.1 400 CDS 100% 2.640 2.112 N Pogk n/a
4 TRCN0000095263 GCTCTTGAAATCGCCCAGGAA pLKO.1 989 CDS 100% 2.640 2.112 N Pogk n/a
5 TRCN0000095262 CAGCATCTCAAGTGAATCAAT pLKO.1 1792 CDS 100% 5.625 3.938 N Pogk n/a
6 TRCN0000095260 CCTCTGAATTTGACCCTGAAA pLKO.1 143 CDS 100% 4.950 3.465 N Pogk n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5407 3UTR 100% 4.050 2.025 Y Mtif2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2792 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08753 pDONR223 100% 84.3% 88.2% None (many diffs) n/a
2 ccsbBroad304_08753 pLX_304 0% 84.3% 88.2% V5 (many diffs) n/a
3 TRCN0000474134 AATCGAGTCAGAACACCTCGGCGC pLX_317 27.2% 84.3% 88.2% V5 (many diffs) n/a
Download CSV