Transcript: Human NM_001143775.2

Homo sapiens CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CTDNEP1 (23399)
Length:
1767
CDS:
439..1173

Additional Resources:

NCBI RefSeq record:
NM_001143775.2
NBCI Gene record:
CTDNEP1 (23399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247430 AGGCAGATCCGCACGGTAATT pLKO_005 526 CDS 100% 13.200 18.480 N Ctdnep1 n/a
2 TRCN0000006912 GCACGGTAATTCAGTACCAAA pLKO.1 536 CDS 100% 4.950 6.930 N CTDNEP1 n/a
3 TRCN0000277825 GCACGGTAATTCAGTACCAAA pLKO_005 536 CDS 100% 4.950 6.930 N CTDNEP1 n/a
4 TRCN0000247431 TTCATCCTCAAGGTGGTAATA pLKO_005 715 CDS 100% 13.200 10.560 N Ctdnep1 n/a
5 TRCN0000006914 GATCTGGATGAGACACTTATT pLKO.1 637 CDS 100% 13.200 9.240 N CTDNEP1 n/a
6 TRCN0000277823 GATCTGGATGAGACACTTATT pLKO_005 637 CDS 100% 13.200 9.240 N CTDNEP1 n/a
7 TRCN0000006913 CCAGCATTGTGATCCTGGATA pLKO.1 977 CDS 100% 4.950 3.465 N CTDNEP1 n/a
8 TRCN0000277755 CCAGCATTGTGATCCTGGATA pLKO_005 977 CDS 100% 4.950 3.465 N CTDNEP1 n/a
9 TRCN0000006911 CCTCACTCTTAACTTCGTGTT pLKO.1 1365 3UTR 100% 4.050 2.835 N CTDNEP1 n/a
10 TRCN0000277822 CCTCACTCTTAACTTCGTGTT pLKO_005 1365 3UTR 100% 4.050 2.835 N CTDNEP1 n/a
11 TRCN0000006915 CCCATCAAATCCTGGTTCAGT pLKO.1 1039 CDS 100% 3.000 2.100 N CTDNEP1 n/a
12 TRCN0000277824 CCCATCAAATCCTGGTTCAGT pLKO_005 1039 CDS 100% 3.000 2.100 N CTDNEP1 n/a
13 TRCN0000247433 CCGAAACCTTCACCAACATAG pLKO_005 1143 CDS 100% 10.800 7.560 N Ctdnep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07878 pDONR223 100% 99.8% 100% None 82C>T n/a
2 ccsbBroad304_07878 pLX_304 0% 99.8% 100% V5 82C>T n/a
3 TRCN0000473862 CCCTGGAGGACGTGGTAGCTCGGC pLX_317 66.6% 99.8% 100% V5 82C>T n/a
Download CSV