Transcript: Human NM_001143784.1

Homo sapiens FES proto-oncogene, tyrosine kinase (FES), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
FES (2242)
Length:
2477
CDS:
1..2259

Additional Resources:

NCBI RefSeq record:
NM_001143784.1
NBCI Gene record:
FES (2242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231680 ATCAGCAGACACGGGAGTTTG pLKO_005 2087 CDS 100% 10.800 15.120 N FES n/a
2 TRCN0000361154 ATCAGCAGACACGGGAGTTTG pLKO_005 2087 CDS 100% 10.800 15.120 N Fes n/a
3 TRCN0000199154 CAACAGGAGCTCCGGAATGAA pLKO.1 1003 CDS 100% 5.625 7.875 N FES n/a
4 TRCN0000199061 CGGCTCCAGCTCATATGCTGA pLKO.1 2317 3UTR 100% 0.000 0.000 N FES n/a
5 TRCN0000255348 TGCAGGAATACCTGGAGATTA pLKO_005 680 CDS 100% 13.200 9.240 N FES n/a
6 TRCN0000380695 ACAAGGCTAAGGACAAGTATG pLKO_005 497 CDS 100% 10.800 7.560 N FES n/a
7 TRCN0000231678 ACCCACGCTGGAGATCCTTAA pLKO_005 1263 CDS 100% 10.800 7.560 N FES n/a
8 TRCN0000231676 CTACTGGAGGGCATGAGAAAG pLKO_005 76 CDS 100% 10.800 7.560 N FES n/a
9 TRCN0000231679 CTGACCTCAAGGCCAAGTTTC pLKO_005 1583 CDS 100% 10.800 7.560 N FES n/a
10 TRCN0000379569 TGGTGTTGGGTGAGCAGATTG pLKO_005 1472 CDS 100% 10.800 7.560 N FES n/a
11 TRCN0000369029 CAGAAGCAGCCCATCTACATC pLKO_005 1672 CDS 100% 4.950 3.465 N FES n/a
12 TRCN0000000627 GAGAAGAATGTCCTGAAGATC pLKO.1 1867 CDS 100% 4.950 3.465 N FES n/a
13 TRCN0000000624 CAAGGCCAAGTTTCTACAGGA pLKO.1 1590 CDS 100% 2.640 1.848 N FES n/a
14 TRCN0000000625 CATTCCTTTGCTCATCGACCA pLKO.1 1356 CDS 100% 2.160 1.512 N FES n/a
15 TRCN0000199245 CTTCTCAAGCTGGTGGCCTCT pLKO.1 2272 3UTR 100% 0.720 0.504 N FES n/a
16 TRCN0000196932 GCTCATATGCTGACAGCTCTT pLKO.1 2325 3UTR 100% 0.000 0.000 N FES n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14637 pDONR223 0% 91.4% 91.4% None 504T>C;1320_1321ins210 n/a
2 ccsbBroad304_14637 pLX_304 0% 91.4% 91.4% V5 504T>C;1320_1321ins210 n/a
3 TRCN0000479440 CCTAATGATTTCCCATTACAGGGA pLX_317 12.8% 91.4% 91.4% V5 504T>C;1320_1321ins210;2256delG n/a
4 TRCN0000491795 CTCAGGGGGTATCAGACGTGAACA pLX_317 7.6% 91.4% 91.4% V5 (not translated due to prior stop codon) 15C>T;504T>C;1320_1321ins210 n/a
Download CSV