Transcript: Human NM_001143813.2

Homo sapiens brain derived neurotrophic factor (BDNF), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BDNF (627)
Length:
3967
CDS:
296..1039

Additional Resources:

NCBI RefSeq record:
NM_001143813.2
NBCI Gene record:
BDNF (627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371420 GTATGTACATTGACCATTAAA pLKO_005 1007 CDS 100% 15.000 21.000 N BDNF n/a
2 TRCN0000371421 ACAGTGGTTCTACAATCTATT pLKO_005 1174 3UTR 100% 13.200 18.480 N BDNF n/a
3 TRCN0000058210 GCCCTTACCATGGATAGCAAA pLKO.1 944 CDS 100% 4.950 3.960 N BDNF n/a
4 TRCN0000225731 GAATTGGCTGGCGATTCATAA pLKO_005 969 CDS 100% 13.200 9.240 N Bdnf n/a
5 TRCN0000371395 GAATTGGCTGGCGATTCATAA pLKO_005 969 CDS 100% 13.200 9.240 N BDNF n/a
6 TRCN0000225729 TTTCCTTACTATGGTTATTTC pLKO_005 307 CDS 100% 13.200 9.240 N Bdnf n/a
7 TRCN0000058212 CTGTTGGATGAGGACCAGAAA pLKO.1 503 CDS 100% 4.950 3.465 N BDNF n/a
8 TRCN0000058211 GAAGCAAACATCCGAGGACAA pLKO.1 362 CDS 100% 4.050 2.835 N BDNF n/a
9 TRCN0000058208 GCTCAGTAGTCAAGTGCCTTT pLKO.1 580 CDS 100% 4.050 2.835 N BDNF n/a
10 TRCN0000058209 GCAATACTTCTACGAGACCAA pLKO.1 829 CDS 100% 2.640 1.848 N BDNF n/a
11 TRCN0000225730 TGAGCGTGTGTGACAGTATTA pLKO_005 708 CDS 100% 13.200 7.920 N Bdnf n/a
12 TRCN0000143693 GAGCCAAATGTGGCATTTGAA pLKO.1 2573 3UTR 100% 0.563 0.281 Y PIGT n/a
13 TRCN0000280842 GAGCCAAATGTGGCATTTGAA pLKO_005 2573 3UTR 100% 0.563 0.281 Y PIGT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05886 pDONR223 100% 99.7% 99.5% None 196G>A;354T>C n/a
2 ccsbBroad304_05886 pLX_304 0% 99.7% 99.5% V5 196G>A;354T>C n/a
3 TRCN0000492149 TTAGCTCCGTGCCGCGATATGAAA pLX_317 55.5% 99.7% 99.5% V5 196G>A;354T>C n/a
Download CSV