Transcript: Human NM_001143976.1

Homo sapiens WEE1 G2 checkpoint kinase (WEE1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
WEE1 (7465)
Length:
3234
CDS:
756..2054

Additional Resources:

NCBI RefSeq record:
NM_001143976.1
NBCI Gene record:
WEE1 (7465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274664 CGCTCTGTCAGCCTTACTATA pLKO_005 2028 CDS 100% 13.200 18.480 N Wee1 n/a
2 TRCN0000219074 ATAAACCGATCTTCGTGATAC pLKO_005 2958 3UTR 100% 10.800 15.120 N WEE1 n/a
3 TRCN0000195434 CCGGATTCTTTGTTGCTTCAT pLKO.1 831 CDS 100% 4.950 6.930 N WEE1 n/a
4 TRCN0000274663 CTTTGGTTCACATGGATATAA pLKO_005 1375 CDS 100% 15.000 12.000 N Wee1 n/a
5 TRCN0000226424 TTCTCATGTAGTTCGATATTT pLKO_005 1181 CDS 100% 15.000 12.000 N WEE1 n/a
6 TRCN0000196435 GAAGTTTAGCTGATGCTATAA pLKO.1 1258 CDS 100% 13.200 9.240 N WEE1 n/a
7 TRCN0000196638 GCTGTAAACTTGTAGCATTAA pLKO.1 2622 3UTR 100% 13.200 9.240 N WEE1 n/a
8 TRCN0000226425 GTGGGCAGAAGATGATCATAT pLKO_005 1208 CDS 100% 13.200 9.240 N WEE1 n/a
9 TRCN0000226426 TAATAGAACATCTCGACTTAT pLKO_005 1991 CDS 100% 13.200 9.240 N WEE1 n/a
10 TRCN0000218323 ATGGATGCATTTATGCCATTA pLKO_005 1075 CDS 100% 10.800 7.560 N WEE1 n/a
11 TRCN0000196910 GCAATATGAAGTCCCGGTATA pLKO.1 979 CDS 100% 10.800 7.560 N WEE1 n/a
12 TRCN0000197067 GCTGTTTGAAATGCCAGAATG pLKO.1 2987 3UTR 100% 10.800 7.560 N WEE1 n/a
13 TRCN0000001701 CTAGAAAGAGTGCAGAACAAT pLKO.1 1831 CDS 100% 5.625 3.938 N WEE1 n/a
14 TRCN0000001703 AGATGAAACAAGACCTGCTAA pLKO.1 938 CDS 100% 4.950 3.465 N WEE1 n/a
15 TRCN0000001700 CCACCCAGAGTAATAGAACAT pLKO.1 1981 CDS 100% 4.950 3.465 N WEE1 n/a
16 TRCN0000001704 GCCAGTGATTATGAGCTTGAA pLKO.1 918 CDS 100% 4.950 3.465 N WEE1 n/a
17 TRCN0000001702 GCCTTGTGAATTTGCTGCTAT pLKO.1 2586 3UTR 100% 4.950 3.465 N WEE1 n/a
18 TRCN0000025671 CCACCCAGAGTAATAGAACTT pLKO.1 1981 CDS 100% 4.950 3.465 N Wee1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489041 CACATTGGCTCCGGCCTGGTTTAT pLX_317 20.7% 66.8% 66.8% V5 (not translated due to prior stop codon) 0_1ins642 n/a
2 TRCN0000488292 TCCAGAGCGACCATCCGGCACCAC pLX_317 14% 66.8% 66.7% V5 0_1ins642;1296_1297insG n/a
Download CSV