Transcript: Human NM_001144070.2

Homo sapiens ATP binding cassette subfamily C member 3 (ABCC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ABCC3 (8714)
Length:
1861
CDS:
57..1775

Additional Resources:

NCBI RefSeq record:
NM_001144070.2
NBCI Gene record:
ABCC3 (8714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059403 CGCTGATCTTACAACACTATT pLKO.1 1147 CDS 100% 13.200 18.480 N ABCC3 n/a
2 TRCN0000059407 CGCAAAGAATGTCGACCCTAA pLKO.1 650 CDS 100% 4.050 5.670 N ABCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01998 pDONR223 100% 36.4% 35.5% None (many diffs) n/a
2 TRCN0000489457 TCATAAGGGAATTAGTTATCCGGC pLX_317 7.1% 36.4% 35.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491674 TAACCTACCTTCTGGATACAGATC pLX_317 6.8% 36.4% 35.5% V5 (many diffs) n/a
Download CSV