Transcript: Human NM_001144772.1

Homo sapiens neutral sphingomyelinase activation associated factor (NSMAF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NSMAF (8439)
Length:
3522
CDS:
62..2908

Additional Resources:

NCBI RefSeq record:
NM_001144772.1
NBCI Gene record:
NSMAF (8439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143925 CAGTTACACGAGCACTATAAA pLKO.1 2015 CDS 100% 15.000 21.000 N NSMAF n/a
2 TRCN0000278394 CAGTTACACGAGCACTATAAA pLKO_005 2015 CDS 100% 15.000 21.000 N NSMAF n/a
3 TRCN0000140313 CGAAACCTGTGGTCCAGATAA pLKO.1 840 CDS 100% 13.200 10.560 N NSMAF n/a
4 TRCN0000145430 GCCATTAGTTGCTATTCTCTT pLKO.1 3071 3UTR 100% 4.950 3.960 N NSMAF n/a
5 TRCN0000297440 GCCATTAGTTGCTATTCTCTT pLKO_005 3071 3UTR 100% 4.950 3.960 N NSMAF n/a
6 TRCN0000145365 GCAGAGAATAGCTAAGAGATA pLKO.1 3189 3UTR 100% 4.950 3.465 N NSMAF n/a
7 TRCN0000278396 GCAGAGAATAGCTAAGAGATA pLKO_005 3189 3UTR 100% 4.950 3.465 N NSMAF n/a
8 TRCN0000141711 GCCCATCATCAAGATTCCTTT pLKO.1 370 CDS 100% 4.950 3.465 N NSMAF n/a
9 TRCN0000278395 GCCCATCATCAAGATTCCTTT pLKO_005 370 CDS 100% 4.950 3.465 N NSMAF n/a
10 TRCN0000142599 GCTATTCTCTTAGGGCAGATA pLKO.1 3081 3UTR 100% 4.950 3.465 N NSMAF n/a
11 TRCN0000144847 GAGTACTACTTTGAACAGCAT pLKO.1 242 CDS 100% 2.640 1.848 N NSMAF n/a
12 TRCN0000278338 GAGTACTACTTTGAACAGCAT pLKO_005 242 CDS 100% 2.640 1.848 N NSMAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07239 pDONR223 100% 95.9% 94.9% None (many diffs) n/a
2 ccsbBroad304_07239 pLX_304 0% 95.9% 94.9% V5 (many diffs) n/a
3 TRCN0000475792 AGCCTGACAGCACTTAAATTCTAA pLX_317 10.8% 95.9% 94.9% V5 (many diffs) n/a
Download CSV