Transcript: Human NM_001144928.2

Homo sapiens NFKB inhibitor interacting Ras like 2 (NKIRAS2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
NKIRAS2 (28511)
Length:
2285
CDS:
130..537

Additional Resources:

NCBI RefSeq record:
NM_001144928.2
NBCI Gene record:
NKIRAS2 (28511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359599 TATGCTCCTATACTGGCATTA pLKO_005 1010 3UTR 100% 10.800 15.120 N NKIRAS2 n/a
2 TRCN0000359529 GGGTCTGAGTTCCTATTATAG pLKO_005 868 3UTR 100% 13.200 9.240 N NKIRAS2 n/a
3 TRCN0000047538 CCAGTTCTCTTGATTTCGTAA pLKO.1 1635 3UTR 100% 4.950 3.465 N NKIRAS2 n/a
4 TRCN0000047539 CCTTGGCAACAAGTGTGACTT pLKO.1 312 CDS 100% 4.950 3.465 N NKIRAS2 n/a
5 TRCN0000368602 TCGTGGTCCTTGGCAACAAGT pLKO_005 305 CDS 100% 4.950 3.465 N NKIRAS2 n/a
6 TRCN0000047541 CAGCTTCTGTATGGGAACCAT pLKO.1 196 CDS 100% 3.000 2.100 N NKIRAS2 n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1321 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03040 pDONR223 100% 70.6% 70.6% None 166_167ins168 n/a
2 ccsbBroad304_03040 pLX_304 0% 70.6% 70.6% V5 166_167ins168 n/a
3 TRCN0000467100 ATAAATGATAGGGGAGCCCGGGCA pLX_317 65.9% 70.6% 70.6% V5 166_167ins168 n/a
Download CSV