Transcript: Human NM_001145036.2

Homo sapiens component of oligomeric golgi complex 2 (COG2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
COG2 (22796)
Length:
2929
CDS:
127..2340

Additional Resources:

NCBI RefSeq record:
NM_001145036.2
NBCI Gene record:
COG2 (22796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343437 AGACGTCTGACGTCGATATAA pLKO_005 785 CDS 100% 15.000 21.000 N COG2 n/a
2 TRCN0000343398 GCGTCTTCTCTCAGCGTATTT pLKO_005 2484 3UTR 100% 13.200 18.480 N COG2 n/a
3 TRCN0000064989 CCATACATAGACGAGGTGATT pLKO.1 886 CDS 100% 4.950 6.930 N COG2 n/a
4 TRCN0000064992 GCACTCATAAGTACTATGAAA pLKO.1 2048 CDS 100% 0.563 0.788 N COG2 n/a
5 TRCN0000343397 GACCTGGAGCTCTACTATAAA pLKO_005 268 CDS 100% 15.000 10.500 N COG2 n/a
6 TRCN0000343438 ATTGAGGCTTATACAAGTTAT pLKO_005 516 CDS 100% 13.200 9.240 N COG2 n/a
7 TRCN0000343440 TGGATCACAGGCTAGTGTAAA pLKO_005 1200 CDS 100% 13.200 9.240 N COG2 n/a
8 TRCN0000064990 CGAACTCATCAACAAGGATTA pLKO.1 309 CDS 100% 10.800 7.560 N COG2 n/a
9 TRCN0000064991 CGGAAACAAAGCCTGTGGTTT pLKO.1 1625 CDS 100% 4.950 3.465 N COG2 n/a
10 TRCN0000064988 CCTGCCTATCACAGCTTCAAT pLKO.1 1237 CDS 100% 5.625 3.375 N COG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02683 pDONR223 100% 99.8% 99.8% None 1648_1649insCAG n/a
2 ccsbBroad304_02683 pLX_304 0% 99.8% 99.8% V5 1648_1649insCAG n/a
3 TRCN0000472219 GTGAGGCCCGCAGTACTAACCTTA pLX_317 17.5% 99.8% 99.8% V5 1648_1649insCAG n/a
Download CSV