Transcript: Human NM_001145157.2

Homo sapiens nuclear receptor subfamily 2 group F member 2 (NR2F2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NR2F2 (7026)
Length:
3532
CDS:
111..896

Additional Resources:

NCBI RefSeq record:
NM_001145157.2
NBCI Gene record:
NR2F2 (7026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026203 CGAGTCTTTGTGTGTTATATT pLKO.1 2017 3UTR 100% 15.000 21.000 N Nr2f2 n/a
2 TRCN0000054475 CTCGTACCTGTCCGGATATAT pLKO.1 176 CDS 100% 15.000 21.000 N Nr2f2 n/a
3 TRCN0000312204 CTCGTACCTGTCCGGATATAT pLKO_005 176 CDS 100% 15.000 21.000 N Nr2f2 n/a
4 TRCN0000005097 GCCGTATATGGCAATTCAATA pLKO.1 875 CDS 100% 13.200 18.480 N NR2F2 n/a
5 TRCN0000342648 GCCGTATATGGCAATTCAATA pLKO_005 875 CDS 100% 13.200 18.480 N NR2F2 n/a
6 TRCN0000054474 CTCCTCAGTCATAGAGCAATT pLKO.1 773 CDS 100% 10.800 8.640 N Nr2f2 n/a
7 TRCN0000312253 CTCCTCAGTCATAGAGCAATT pLKO_005 773 CDS 100% 10.800 8.640 N Nr2f2 n/a
8 TRCN0000005099 CGGATATATTTCCCTGCTGTT pLKO.1 188 CDS 100% 4.050 3.240 N NR2F2 n/a
9 TRCN0000342644 CGGATATATTTCCCTGCTGTT pLKO_005 188 CDS 100% 4.050 3.240 N NR2F2 n/a
10 TRCN0000005096 CGTGATTGATTCAGTATCTTA pLKO.1 1900 3UTR 100% 5.625 3.938 N NR2F2 n/a
11 TRCN0000342600 CGTGATTGATTCAGTATCTTA pLKO_005 1900 3UTR 100% 5.625 3.938 N NR2F2 n/a
12 TRCN0000005100 CCTCCTCAGTCATAGAGCAAT pLKO.1 772 CDS 100% 4.950 3.465 N NR2F2 n/a
13 TRCN0000342646 CCTCCTCAGTCATAGAGCAAT pLKO_005 772 CDS 100% 4.950 3.465 N NR2F2 n/a
14 TRCN0000005098 GTCGCCTTTATGGACCACATA pLKO.1 507 CDS 100% 4.950 3.465 N NR2F2 n/a
15 TRCN0000054477 GACCACATACGGATCTTCCAA pLKO.1 519 CDS 100% 3.000 2.100 N Nr2f2 n/a
16 TRCN0000026188 CGGATATATTTCCCTGCTGCT pLKO.1 188 CDS 100% 2.160 1.728 N Nr2f2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492178 TACGTTGGACATGGCCCACATCTG pLX_317 10.7% 52.4% 58.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489296 AGCCGAGAAACCGAAGATGCCCTT pLX_317 17.3% 52.3% 58.7% V5 (many diffs) n/a
Download CSV