Transcript: Human NM_001145448.2

Homo sapiens zinc finger protein 200 (ZNF200), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZNF200 (7752)
Length:
3005
CDS:
254..1438

Additional Resources:

NCBI RefSeq record:
NM_001145448.2
NBCI Gene record:
ZNF200 (7752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229343 GTCATGAAGGAATCCATATAA pLKO_005 1224 CDS 100% 15.000 10.500 N ZNF200 n/a
2 TRCN0000229344 ACCCGAAAGCAGAAGTAATAC pLKO_005 1421 CDS 100% 13.200 9.240 N ZNF200 n/a
3 TRCN0000229345 TGATCGTGTGGTGCGATTTAG pLKO_005 2605 3UTR 100% 13.200 9.240 N ZNF200 n/a
4 TRCN0000021323 CAGTCCTTTATACTGAGAGTT pLKO.1 296 CDS 100% 4.950 3.465 N ZNF200 n/a
5 TRCN0000021319 CCAAAGCCAAAGCAGTCCTTT pLKO.1 284 CDS 100% 4.950 3.465 N ZNF200 n/a
6 TRCN0000021321 GAACGACTAAATACATCCATT pLKO.1 857 CDS 100% 4.950 3.465 N ZNF200 n/a
7 TRCN0000021322 GAAGATTTGGTCGGCTGTCAA pLKO.1 1362 CDS 100% 4.950 3.465 N ZNF200 n/a
8 TRCN0000218886 CTGTGTGGGAAACAGTTTAAT pLKO_005 1016 CDS 100% 15.000 9.000 N ZNF200 n/a
9 TRCN0000021320 GCTGGTGGTCTTTGAGGATTT pLKO.1 595 CDS 100% 10.800 6.480 N ZNF200 n/a
10 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1156 CDS 100% 15.000 7.500 Y Zfp984 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01818 pDONR223 100% 99.7% 99.7% None 465_466insGCA n/a
2 ccsbBroad304_01818 pLX_304 0% 99.7% 99.7% V5 465_466insGCA n/a
3 TRCN0000476587 CTCTGCAATCATCATATCGTTACC pLX_317 31.2% 99.7% 99.7% V5 465_466insGCA n/a
4 ccsbBroadEn_13985 pDONR223 100% 99.6% 1.5% None 1_3delATG;12delA n/a
5 ccsbBroad304_13985 pLX_304 0% 99.6% 1.5% V5 (not translated due to prior stop codon) 1_3delATG;12delA n/a
Download CSV