Transcript: Human NM_001145468.3

Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1 like (SPECC1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SPECC1L (23384)
Length:
6692
CDS:
205..3558

Additional Resources:

NCBI RefSeq record:
NM_001145468.3
NBCI Gene record:
SPECC1L (23384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155143 GCCAGAACTCAACAGCTATTT pLKO.1 4804 3UTR 100% 13.200 9.240 N SPECC1L n/a
2 TRCN0000155846 CCACTGATGTTCATGTGAGAA pLKO.1 5406 3UTR 100% 4.950 3.465 N SPECC1L n/a
3 TRCN0000112962 CCAGTTCTACTAGAGAAAGAT pLKO.1 560 CDS 100% 5.625 2.813 Y Specc1l n/a
4 TRCN0000155528 GCCACGTTAGAGGAATACAAA pLKO.1 1882 CDS 100% 5.625 2.813 Y SPECC1L n/a
5 TRCN0000156764 GCTGAAAGTGTCGGCATCAAA pLKO.1 3439 CDS 100% 5.625 2.813 Y SPECC1L n/a
6 TRCN0000150331 CAGAGGTTAGACAATTCTGAA pLKO.1 1042 CDS 100% 4.950 2.475 Y SPECC1L n/a
7 TRCN0000155872 CCAGGATAAGAGAAGGAACTT pLKO.1 3399 CDS 100% 4.950 2.475 Y SPECC1L n/a
8 TRCN0000155589 CCGAAATGATGCCAATCGATT pLKO.1 2103 CDS 100% 4.950 2.475 Y SPECC1L n/a
9 TRCN0000155730 CGTGGAGAACAAATCCAAGAT pLKO.1 483 CDS 100% 4.950 2.475 Y SPECC1L n/a
10 TRCN0000154826 GAGCGATAAGTTGGAACACTT pLKO.1 1560 CDS 100% 4.950 2.475 Y SPECC1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07875 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_07875 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476672 AGTGTACCACCTCGAAGCACATGT pLX_317 12.5% 100% 100% V5 n/a
Download CSV