Transcript: Human NM_001145549.3

Homo sapiens thioredoxin domain containing 5 (TXNDC5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TXNDC5 (81567)
Length:
2949
CDS:
327..1301

Additional Resources:

NCBI RefSeq record:
NM_001145549.3
NBCI Gene record:
TXNDC5 (81567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064355 GCCAAAGTCTATGTGGCTAAA pLKO.1 336 CDS 100% 10.800 5.400 Y TXNDC5 n/a
2 TRCN0000333175 GCCAAAGTCTATGTGGCTAAA pLKO_005 336 CDS 100% 10.800 5.400 Y TXNDC5 n/a
3 TRCN0000064356 CGGAATATCTGCAGCAAGTAT pLKO.1 1155 CDS 100% 5.625 2.813 Y TXNDC5 n/a
4 TRCN0000333177 CGGAATATCTGCAGCAAGTAT pLKO_005 1155 CDS 100% 5.625 2.813 Y TXNDC5 n/a
5 TRCN0000064354 GCCAAGCGAAAGACGAACTTT pLKO.1 1279 CDS 100% 5.625 2.813 Y TXNDC5 n/a
6 TRCN0000333258 GCCAAGCGAAAGACGAACTTT pLKO_005 1279 CDS 100% 5.625 2.813 Y TXNDC5 n/a
7 TRCN0000064353 CGACCACTTTATCAAGTTCTT pLKO.1 620 CDS 100% 4.950 2.475 Y TXNDC5 n/a
8 TRCN0000064357 CGAAACTGTCAAGATTGGCAA pLKO.1 713 CDS 100% 2.640 1.320 Y TXNDC5 n/a
9 TRCN0000333176 CGAAACTGTCAAGATTGGCAA pLKO_005 713 CDS 100% 2.640 1.320 Y TXNDC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10525 pDONR223 100% 89.9% 90% None 0_1ins108;966C>T n/a
2 ccsbBroad304_10525 pLX_304 0% 89.9% 90% V5 0_1ins108;966C>T n/a
3 TRCN0000475518 ATAGGTTCCCGGATTGCGTTTCCT pLX_317 30.2% 89.9% 90% V5 0_1ins108;966C>T n/a
Download CSV