Transcript: Human NM_001145661.2

Homo sapiens GATA binding protein 2 (GATA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GATA2 (2624)
Length:
3470
CDS:
436..1878

Additional Resources:

NCBI RefSeq record:
NM_001145661.2
NBCI Gene record:
GATA2 (2624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019265 GAACCGGAAGATGTCCAACAA pLKO.1 1623 CDS 100% 4.950 3.960 N GATA2 n/a
2 TRCN0000355775 CCGGCACCTGTTGTGCAAATT pLKO_005 1469 CDS 100% 13.200 9.240 N GATA2 n/a
3 TRCN0000321462 CTACAAGCTGCACAATGTTAA pLKO_005 1563 CDS 100% 13.200 9.240 N Gata2 n/a
4 TRCN0000355776 ACCCTTAGCAGCCCAGCATTT pLKO_005 1928 3UTR 100% 10.800 7.560 N GATA2 n/a
5 TRCN0000321388 GACGACAACCACCACCTTATG pLKO_005 1494 CDS 100% 10.800 7.560 N Gata2 n/a
6 TRCN0000355783 GACGACAACCACCACCTTATG pLKO_005 1494 CDS 100% 10.800 7.560 N GATA2 n/a
7 TRCN0000019267 CTGGCGCACAACTACATGGAA pLKO.1 520 CDS 100% 3.000 2.100 N GATA2 n/a
8 TRCN0000019266 CGACTACAGCAGCGGACTCTT pLKO.1 1209 CDS 100% 1.650 1.155 N GATA2 n/a
9 TRCN0000019268 CCGACCACTCATCAAGCCCAA pLKO.1 1422 CDS 100% 0.720 0.504 N GATA2 n/a
10 TRCN0000019264 GTGCAAATTGTCAGACGACAA pLKO.1 1481 CDS 100% 0.405 0.284 N GATA2 n/a
11 TRCN0000085419 CTCTACTACAAGCTGCACAAT pLKO.1 1558 CDS 100% 4.950 2.970 N Gata2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06258 pDONR223 100% 99.9% 100% None 15C>G n/a
2 ccsbBroad304_06258 pLX_304 0% 99.9% 100% V5 15C>G n/a
3 TRCN0000480188 CGGTATCCGGCTTGTAACTCAATC pLX_317 25.8% 99.9% 100% V5 15C>G n/a
4 ccsbBroadEn_06257 pDONR223 100% 99.7% 99.7% None 15C>G;490G>A;1431C>A n/a
5 ccsbBroad304_06257 pLX_304 0% 99.7% 99.7% V5 15C>G;490G>A;1431C>A n/a
6 ccsbBroadEn_06259 pDONR223 100% 97% 97% None 15C>G;1017_1058del n/a
7 ccsbBroad304_06259 pLX_304 0% 97% 97% V5 15C>G;1017_1058del n/a
8 TRCN0000479750 CACCCTCCCCCAGGAGTTCTAGAT pLX_317 24.2% 97% 97% V5 15C>G;1017_1058del n/a
Download CSV