Transcript: Human NM_001145794.1

Homo sapiens ANTXR cell adhesion molecule 2 (ANTXR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ANTXR2 (118429)
Length:
2314
CDS:
764..2233

Additional Resources:

NCBI RefSeq record:
NM_001145794.1
NBCI Gene record:
ANTXR2 (118429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063414 CCTGCACCTATCCTGAATAAA pLKO.1 1601 CDS 100% 15.000 21.000 N ANTXR2 n/a
2 TRCN0000063416 GCACTTACACTGTAAATGAAA pLKO.1 1527 CDS 100% 5.625 4.500 N ANTXR2 n/a
3 TRCN0000063413 GAGGAATTTCAGATTGTCTTA pLKO.1 1460 CDS 100% 4.950 3.960 N ANTXR2 n/a
4 TRCN0000371259 CTGTCATTTCAGGATCATTAA pLKO_005 1668 CDS 100% 13.200 9.240 N ANTXR2 n/a
5 TRCN0000371258 GATCGCAGCCATCATTGTTAT pLKO_005 1717 CDS 100% 13.200 9.240 N ANTXR2 n/a
6 TRCN0000063415 GCAAAGATATCCAGGTCACTT pLKO.1 1250 CDS 100% 4.950 3.465 N ANTXR2 n/a
7 TRCN0000063417 GCTGATTCCAAGGAGCAAGTT pLKO.1 1331 CDS 100% 4.950 3.465 N ANTXR2 n/a
8 TRCN0000193404 CTCCAGTATCATAATTGCTTT pLKO.1 1180 CDS 100% 4.950 6.930 N Antxr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13067 pDONR223 100% 28.9% 28.7% None (many diffs) n/a
2 ccsbBroad304_13067 pLX_304 0% 28.9% 28.7% V5 (many diffs) n/a
3 TRCN0000468982 TTGTCGCGATATGTGCAGCCCCCG pLX_317 86.7% 28.9% 28.7% V5 (many diffs) n/a
Download CSV