Transcript: Mouse NM_001145820.1

Mus musculus glycerol phosphate dehydrogenase 2, mitochondrial (Gpd2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gpd2 (14571)
Length:
5745
CDS:
320..2503

Additional Resources:

NCBI RefSeq record:
NM_001145820.1
NBCI Gene record:
Gpd2 (14571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445394 CGTGAGAGCCAAATGCGTTAT pLKO_005 1159 CDS 100% 10.800 15.120 N Gpd2 n/a
2 TRCN0000041494 GCCACGAGATTTCTGTACTAT pLKO.1 2102 CDS 100% 5.625 7.875 N Gpd2 n/a
3 TRCN0000422406 AGAGGTGAAATACGGGATTAA pLKO_005 1924 CDS 100% 13.200 10.560 N Gpd2 n/a
4 TRCN0000429694 GCCTATCATGCTTCCACTTTA pLKO_005 793 CDS 100% 13.200 10.560 N Gpd2 n/a
5 TRCN0000041496 CGTGTCCTAGAGAGTATCAAT pLKO.1 2267 CDS 100% 5.625 4.500 N Gpd2 n/a
6 TRCN0000041495 CCTGAGAACATGGGACTTCTT pLKO.1 1292 CDS 100% 4.950 3.465 N Gpd2 n/a
7 TRCN0000041493 TGACCAGTAAATCCGCCACCA pLKO.1 2507 3UTR 100% 2.160 1.512 N Gpd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10856 pDONR223 100% 45.1% 48.2% None (many diffs) n/a
2 ccsbBroad304_10856 pLX_304 0% 45.1% 48.2% V5 (many diffs) n/a
3 TRCN0000467472 AGTCTTCAAAGTAGTGTTAGGGAT pLX_317 38.9% 45.1% 48.2% V5 (many diffs) n/a
Download CSV