Transcript: Mouse NM_001145830.1

Mus musculus phospholipase C, beta 1 (Plcb1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Plcb1 (18795)
Length:
6998
CDS:
370..4020

Additional Resources:

NCBI RefSeq record:
NM_001145830.1
NBCI Gene record:
Plcb1 (18795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435280 TCTAACCTGGTGAACTATATT pLKO_005 1990 CDS 100% 15.000 21.000 N Plcb1 n/a
2 TRCN0000429550 ATCTGATCCAGAGCGTGTTAA pLKO_005 3056 CDS 100% 13.200 18.480 N Plcb1 n/a
3 TRCN0000428549 GTAATCGAAGCTCTATCAAAC pLKO_005 2785 CDS 100% 10.800 15.120 N Plcb1 n/a
4 TRCN0000218583 AGTGTCAGAACAATCAGTTAA pLKO_005 3512 CDS 100% 13.200 9.240 N PLCB1 n/a
5 TRCN0000426090 AGTGTCAGAACAATCAGTTAA pLKO_005 3512 CDS 100% 13.200 9.240 N Plcb1 n/a
6 TRCN0000076908 CCTCCAGTGAGGAGATAGAAA pLKO.1 3962 CDS 100% 5.625 3.938 N Plcb1 n/a
7 TRCN0000076911 GCTGTCTTTGTCTACATAGAA pLKO.1 2731 CDS 100% 5.625 3.938 N Plcb1 n/a
8 TRCN0000076909 CCCGGCTCAATGAAATCCTTT pLKO.1 1136 CDS 100% 4.950 3.465 N Plcb1 n/a
9 TRCN0000076912 CGCATGATAACTGTGGTGTAT pLKO.1 670 CDS 100% 4.950 3.465 N Plcb1 n/a
10 TRCN0000076910 GCAGATAAACATGGGCATGTA pLKO.1 2268 CDS 100% 4.950 3.465 N Plcb1 n/a
11 TRCN0000226443 TTCGGCCAGGCTATCACTATA pLKO_005 2669 CDS 100% 13.200 18.480 N PLCB1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5771 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07859 pDONR223 100% 89.1% 97.3% None (many diffs) n/a
2 ccsbBroad304_07859 pLX_304 0% 89.1% 97.3% V5 (many diffs) n/a
3 TRCN0000471930 CGACTGTTATCACCCAATCAACCT pLX_317 12.8% 89.1% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_15752 pDONR223 0% 85.5% 92.8% None (many diffs) n/a
5 ccsbBroad304_15752 pLX_304 0% 85.5% 92.8% V5 (many diffs) n/a
Download CSV