Transcript: Mouse NM_001145967.1

Mus musculus autophagy related 4C, cysteine peptidase (Atg4c), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Atg4c (242557)
Length:
2854
CDS:
197..1573

Additional Resources:

NCBI RefSeq record:
NM_001145967.1
NBCI Gene record:
Atg4c (242557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030945 GCCATTGAAGATCATGTAATT pLKO.1 392 CDS 100% 13.200 18.480 N Atg4c n/a
2 TRCN0000030946 CGGCAAACCTAAACAGTCATA pLKO.1 1168 CDS 100% 4.950 6.930 N Atg4c n/a
3 TRCN0000030947 GCCATTCCAAAGACTTTGATT pLKO.1 1458 CDS 100% 5.625 3.938 N Atg4c n/a
4 TRCN0000030948 GAAATATAGTTGGGTGTTGAA pLKO.1 265 CDS 100% 4.950 3.465 N Atg4c n/a
5 TRCN0000030944 CCTTGAATACTGTGTAGGTAT pLKO.1 1141 CDS 100% 4.950 2.970 N Atg4c n/a
6 TRCN0000086233 CCTTCCTTTCTTTCTTTCTTT pLKO.1 2195 3UTR 100% 5.625 2.813 Y Pou1f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04451 pDONR223 100% 88% 90.3% None (many diffs) n/a
2 ccsbBroad304_04451 pLX_304 0% 88% 90.3% V5 (many diffs) n/a
3 TRCN0000467723 CTCGGAATCATCGAAAGATTCCTT pLX_317 27.7% 88% 90.3% V5 (many diffs) n/a
Download CSV