Construct: ORF TRCN0000467723
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002638.1_s317c1
- Derived from:
- ccsbBroadEn_04451
- DNA Barcode:
- CTCGGAATCATCGAAAGATTCCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATG4C (84938)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467723
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84938 | ATG4C | autophagy related 4C cystei... | NM_032852.4 | 100% | 100% | |
| 2 | human | 84938 | ATG4C | autophagy related 4C cystei... | NM_178221.2 | 100% | 100% | |
| 3 | human | 84938 | ATG4C | autophagy related 4C cystei... | XM_005271288.2 | 100% | 100% | |
| 4 | human | 84938 | ATG4C | autophagy related 4C cystei... | XM_024450414.1 | 100% | 100% | |
| 5 | human | 84938 | ATG4C | autophagy related 4C cystei... | XM_017002600.1 | 91.2% | 91.2% | 1087_1088ins120 |
| 6 | human | 84938 | ATG4C | autophagy related 4C cystei... | XM_017002601.2 | 91.2% | 91.2% | 1087_1088ins120 |
| 7 | human | 84938 | ATG4C | autophagy related 4C cystei... | XM_011542313.2 | 89.9% | 88.7% | (many diffs) |
| 8 | human | 84938 | ATG4C | autophagy related 4C cystei... | XR_001737493.2 | 46.4% | 1_178del;972_973ins137;1416_2526del | |
| 9 | human | 84938 | ATG4C | autophagy related 4C cystei... | XR_001737492.1 | 45.8% | 1_210del;1004_1005ins137;1448_2558del | |
| 10 | human | 84938 | ATG4C | autophagy related 4C cystei... | XR_001737494.2 | 41.9% | (many diffs) | |
| 11 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | NM_001145967.1 | 88% | 90.3% | (many diffs) |
| 12 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | NM_175029.3 | 88% | 90.3% | (many diffs) |
| 13 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XM_006503071.3 | 84.6% | 86.8% | (many diffs) |
| 14 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XM_006503072.3 | 77.2% | 79.2% | (many diffs) |
| 15 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XM_006503073.3 | 69.3% | 70.7% | (many diffs) |
| 16 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XR_867864.2 | 13.6% | (many diffs) | |
| 17 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XR_867862.2 | 13.3% | (many diffs) | |
| 18 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XR_867860.2 | 13.1% | (many diffs) | |
| 19 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XR_867865.2 | 10.7% | (many diffs) | |
| 20 | mouse | 242557 | Atg4c | autophagy related 4C, cyste... | XR_376316.3 | 10.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1440
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggctacagga acagatgaag ttgacaagct aaaaaccaaa tttatatctg 121 cttggaacaa catgaaatat agttgggtgt tgaaaacaaa gacgtatttt agtagaaatt 181 ctcctgtatt attgcttgga aaatgttacc attttaaata tgaagatgaa gataaaacgt 241 tacctgcaga gtcgggatgt acaatagagg atcacgtaat tgcaggaaat gtagaagaat 301 ttcgtaaaga tttcatttct agaatatggc tgacctacag ggaagaattc cctcaaatag 361 aaggctcagc tttgacaaca gactgtgggt ggggctgcac attgagaact ggccagatgc 421 tcttggctca aggactcata ctacactttc ttggtagagc ttggacctgg cctgatgctt 481 tgaatattga aaattcagac tctgaatcat ggacttccca cactgtcaaa aaatttactg 541 catcatttga agcatcactt tcaggggaaa gagaattcaa aaccccaaca atttctctga 601 aggaaacaat tgggaaatat tctgatgatc atgaaatgcg aaatgaagtt tatcatagga 661 aaatcatctc ttggtttggt gattccccct tggctctttt tggcttacat caactaatag 721 aatatggaaa gaagtctggg aaaaaagcag gagattggta tggaccagct gtggttgctc 781 acattttaag aaaagcagtt gaagaagcaa ggcatcctga tttacaagga ataactattt 841 atgttgcaca agattgtaca gtttacaatt ctgatgtaat tgataaacag agtgcttcca 901 tgacttctga taatgcagat gacaaagctg ttattattct agttcctgtt agacttggtg 961 gagaaagaac caacaccgac tacttagaat ttgtgaaggg tattttaagc ctggaatatt 1021 gtgtgggtat tattggtggc aaacctaaac agtcatatta cttTGCTGGA TTTCAAGATG 1081 ACAGTTTGAT TTACATGGAT CCTCATTACT GCCAATCTTT TGTAGATGTC AGCATAAAGG 1141 ATTTCCCTCT TGAGACATTC CACTGCCCTT CTCCCAAAAA GATGTCTTTT CGAAAAATGG 1201 ATCCCAGCTG TACAATAGGA TTTTACTGTC GAAATGTTCA GGACTTCAAA CGAGCTTCTG 1261 AAGAAATCAC CAAGATGCTG AAATTTTCTT CTAAGGAGAA ATATCCCTTA TTTACTTTTG 1321 TAAATGGTCA TTCCAGAGAC TATGATTTTA CATCTACTAC AACCAATGAA GAAGACCTTT 1381 TTTCAGAGGA TGAAAAGAAA CAATTAAAAA GATTTAGCAC GGAAGAGTTT GTCTTGCTTT 1441 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGACTCGG AATCATCGAA AGATTCCTTA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt