Transcript: Human NM_001146.5

Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ANGPT1 (284)
Length:
4230
CDS:
361..1857

Additional Resources:

NCBI RefSeq record:
NM_001146.5
NBCI Gene record:
ANGPT1 (284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058639 GCTTGGTTACTCGTCAAACAT pLKO.1 1022 CDS 100% 5.625 7.875 N ANGPT1 n/a
2 TRCN0000058640 CCCTCATGTTAACAGGAGGAT pLKO.1 1679 CDS 100% 2.640 3.696 N ANGPT1 n/a
3 TRCN0000371307 CCAGCAATAAGTGGTAGTTAT pLKO_005 1963 3UTR 100% 13.200 10.560 N ANGPT1 n/a
4 TRCN0000058641 CGTTCCACAACTATGATGATT pLKO.1 1819 CDS 100% 5.625 4.500 N ANGPT1 n/a
5 TRCN0000371308 TGGAAATCCCTCCGGTGAATA pLKO_005 1404 CDS 100% 13.200 9.240 N ANGPT1 n/a
6 TRCN0000058638 CCCAGGTACTAAATCAAACTT pLKO.1 809 CDS 100% 5.625 3.938 N ANGPT1 n/a
7 TRCN0000058642 CCTTGTCAATCTTTGCACTAA pLKO.1 1140 CDS 100% 4.950 3.465 N ANGPT1 n/a
8 TRCN0000068221 GCTGCCATTCTGACTCACATA pLKO.1 391 CDS 100% 4.950 3.465 N Angpt1 n/a
9 TRCN0000068218 CCCAGGTACTAAATCAAACAT pLKO.1 809 CDS 100% 5.625 3.938 N Angpt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10677 pDONR223 100% 29.5% 29.5% None 1_762del;805_807delGGT;1207_1494del n/a
2 ccsbBroad304_10677 pLX_304 0% 29.5% 29.5% V5 1_762del;805_807delGGT;1207_1494del n/a
3 TRCN0000475147 TCATGCGTAATGATATACTCGCGC pLX_317 98.2% 29.5% 29.5% V5 1_762del;805_807delGGT;1207_1494del n/a
Download CSV