Transcript: Human NM_001146040.2

Homo sapiens glycine receptor alpha 1 (GLRA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
GLRA1 (2741)
Length:
1836
CDS:
303..1676

Additional Resources:

NCBI RefSeq record:
NM_001146040.2
NBCI Gene record:
GLRA1 (2741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008727 AGGGCCAAGAAGATCGACAAA pLKO.1 1557 CDS 100% 4.950 6.930 N GLRA1 n/a
2 TRCN0000008724 CCCAAGGTGTCCTATGTGAAA pLKO.1 1209 CDS 100% 4.950 3.465 N GLRA1 n/a
3 TRCN0000008726 GCAGATGGGTTACTACCTGAT pLKO.1 1040 CDS 100% 4.050 2.835 N GLRA1 n/a
4 TRCN0000011463 CCGCTTTAACTTCTCTGCCTA pLKO.1 1406 CDS 100% 2.640 1.848 N GLRA1 n/a
5 TRCN0000008725 GCACTACAACACAGGTAAATT pLKO.1 986 CDS 100% 15.000 9.000 N GLRA1 n/a
6 TRCN0000089361 CACAGGTAAATTCACCTGCAT pLKO.1 995 CDS 100% 0.264 0.158 N Glra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06284 pDONR223 100% 99.8% 99.7% None 90C>A;638C>A n/a
2 ccsbBroad304_06284 pLX_304 0% 99.8% 99.7% V5 90C>A;638C>A n/a
3 TRCN0000477267 AATTTGTACTGATGTGACGGTCAG pLX_317 15.6% 99.8% 99.7% V5 90C>A;638C>A n/a
Download CSV