Transcript: Human NM_001146055.2

Homo sapiens synuclein alpha (SNCA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SNCA (6622)
Length:
3030
CDS:
79..501

Additional Resources:

NCBI RefSeq record:
NM_001146055.2
NBCI Gene record:
SNCA (6622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320648 AGGACCAGTTGGGCAAGAATG pLKO_005 368 CDS 100% 10.800 15.120 N SNCA n/a
2 TRCN0000272343 GTTCTCTATGTAGGCTCCAAA pLKO_005 187 CDS 100% 4.950 6.930 N SNCA n/a
3 TRCN0000003737 CCTTCAATCCTGTCAATGTTT pLKO.1 1367 3UTR 100% 5.625 4.500 N SNCA n/a
4 TRCN0000272344 ATGAAACTATGCACCTATAAA pLKO_005 954 3UTR 100% 15.000 10.500 N SNCA n/a
5 TRCN0000003736 ACCAAAGAGCAAGTGACAAAT pLKO.1 253 CDS 100% 13.200 9.240 N SNCA n/a
6 TRCN0000272292 ACCAAAGAGCAAGTGACAAAT pLKO_005 253 CDS 100% 13.200 9.240 N SNCA n/a
7 TRCN0000320563 GTTAGTGATTTGCTATCATAT pLKO_005 836 3UTR 100% 13.200 9.240 N SNCA n/a
8 TRCN0000320570 TGACAATGAGGCTTATGAAAT pLKO_005 438 CDS 100% 13.200 9.240 N SNCA n/a
9 TRCN0000366590 TGACTACCACTTATTTCTAAA pLKO_005 779 3UTR 100% 13.200 9.240 N Snca n/a
10 TRCN0000376934 CCAAAGAGCAAGTGACAAATG pLKO_005 254 CDS 100% 10.800 7.560 N Snca n/a
11 TRCN0000320569 GAAGCCTAAGAAATATCTTTG pLKO_005 493 CDS 100% 10.800 7.560 N SNCA n/a
12 TRCN0000003735 CTGACAATGAGGCTTATGAAA pLKO.1 437 CDS 100% 5.625 3.938 N SNCA n/a
13 TRCN0000010813 AGACTACGAACCTGAAGCCTA pLKO.1 480 CDS 100% 2.640 1.848 N SNCA n/a
14 TRCN0000003734 CTGGAAGATATGCCTGTGGAT pLKO.1 415 CDS 100% 2.640 1.848 N SNCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01563 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01563 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473031 ACAGATCCTCGTATCTCAGAACGT pLX_317 100% 100% 100% V5 n/a
Download CSV