Transcript: Human NM_001146077.1

Homo sapiens claudin 14 (CLDN14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CLDN14 (23562)
Length:
1469
CDS:
379..1098

Additional Resources:

NCBI RefSeq record:
NM_001146077.1
NBCI Gene record:
CLDN14 (23562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441467 GTACAGGCTGAACGACTACGT pLKO_005 1074 CDS 100% 2.640 2.112 N CLDN14 n/a
2 TRCN0000419327 ATAATGTGAATGCGAGGAAAT pLKO_005 1217 3UTR 100% 10.800 7.560 N CLDN14 n/a
3 TRCN0000082914 AGCGGCATGAAGTTTGAGATT pLKO.1 838 CDS 100% 4.950 3.465 N CLDN14 n/a
4 TRCN0000082915 CCAGCTGCCTACAAAGACAAT pLKO.1 1018 CDS 100% 4.950 3.465 N CLDN14 n/a
5 TRCN0000082913 CAAAGTTTACTTCTGGGCAAT pLKO.1 1180 3UTR 100% 4.050 2.835 N CLDN14 n/a
6 TRCN0000437301 CTTTAGAGCACAGGGACAGAG pLKO_005 1240 3UTR 100% 4.050 2.835 N CLDN14 n/a
7 TRCN0000082916 ACACCCGCCAAGACCACCTTT pLKO.1 709 CDS 100% 1.650 1.155 N CLDN14 n/a
8 TRCN0000082917 CCTACCTGAAAGGGCTCTGGA pLKO.1 512 CDS 100% 0.880 0.616 N CLDN14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02795 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02795 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475201 CGGTCCGCGGCCATCACATTACTA pLX_317 59.5% 100% 100% V5 n/a
Download CSV