Transcript: Human NM_001146343.2

Homo sapiens solute carrier family 66 member 2 (SLC66A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
SLC66A2 (80148)
Length:
2273
CDS:
173..571

Additional Resources:

NCBI RefSeq record:
NM_001146343.2
NBCI Gene record:
SLC66A2 (80148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426935 GACCAGTGGTGACGCCTTCAA pLKO_005 531 CDS 100% 1.650 2.310 N SLC66A2 n/a
2 TRCN0000153358 GATACTCTTCTGGTTTGGAAG pLKO.1 364 CDS 100% 4.050 3.240 N SLC66A2 n/a
3 TRCN0000418897 ACGCCTTCAAGACGGCCTACT pLKO_005 542 CDS 100% 1.350 1.080 N SLC66A2 n/a
4 TRCN0000157954 CGGATACTCTTCTGGTTTGGA pLKO.1 362 CDS 100% 3.000 2.100 N SLC66A2 n/a
5 TRCN0000438366 AGAGCGCCATCATGATCCTGA pLKO_005 411 CDS 100% 2.640 1.848 N SLC66A2 n/a
6 TRCN0000439309 ATGGTGCTCATGTGGACCAGT pLKO_005 517 CDS 100% 2.640 1.848 N SLC66A2 n/a
7 TRCN0000156750 GCCTGAAGCAAATTCCTGAGT pLKO.1 1710 3UTR 100% 2.640 1.848 N SLC66A2 n/a
8 TRCN0000437131 AGTATCGGGACATTCGCAGGA pLKO_005 279 CDS 100% 2.160 1.512 N SLC66A2 n/a
9 TRCN0000423240 GACATTCGCAGGACGCAGAAC pLKO_005 287 CDS 100% 1.350 0.945 N SLC66A2 n/a
10 TRCN0000200254 CTTCAAGACGGCCTACTTCTT pLKO.1 546 CDS 100% 4.950 3.465 N Pqlc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04177 pDONR223 100% 48.7% 42% None 335_336ins271;396_397ins146 n/a
2 ccsbBroad304_04177 pLX_304 0% 48.7% 42% V5 335_336ins271;396_397ins146 n/a
3 TRCN0000479482 GGTCTCTGCTCCGCCTTTGCGGCG pLX_317 38.9% 48.7% 42% V5 335_336ins271;396_397ins146 n/a
Download CSV