Construct: ORF TRCN0000479482
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009978.1_s317c1
- Derived from:
- ccsbBroadEn_04177
- DNA Barcode:
- GGTCTCTGCTCCGCCTTTGCGGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC66A2 (80148)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479482
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80148 | SLC66A2 | solute carrier family 66 me... | NM_025078.5 | 100% | 100% | |
| 2 | human | 80148 | SLC66A2 | solute carrier family 66 me... | NM_001146345.2 | 93.3% | 93.3% | 336_337ins54 |
| 3 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017025997.1 | 91.5% | 91.2% | 203_277del |
| 4 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017025998.1 | 85.4% | 85.1% | 203_277del;411_412ins54 |
| 5 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_024451267.1 | 69.3% | 69.3% | 0_1ins249 |
| 6 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017026001.2 | 65.2% | 61% | (many diffs) |
| 7 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_005266770.2 | 55.3% | 48.2% | 390_391ins217;450_451ins146 |
| 8 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017026000.1 | 55.2% | 47.3% | (many diffs) |
| 9 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_011526188.1 | 53.3% | 51.4% | (many diffs) |
| 10 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017026005.1 | 53.3% | 51.4% | (many diffs) |
| 11 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017026003.1 | 50.6% | 43.8% | 203_277del;465_466ins217;525_526ins146 |
| 12 | human | 80148 | SLC66A2 | solute carrier family 66 me... | NM_001146343.2 | 48.7% | 42% | 335_336ins271;396_397ins146 |
| 13 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XM_017026004.1 | 44.5% | 38.2% | 203_277del;410_411ins271;471_472ins146 |
| 14 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XR_001753281.1 | 41% | (many diffs) | |
| 15 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XR_001753282.1 | 30.7% | 1_184del;576_659del;1082_2640del | |
| 16 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XR_001753279.1 | 29.9% | (many diffs) | |
| 17 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XR_002958186.1 | 26.2% | (many diffs) | |
| 18 | human | 80148 | SLC66A2 | solute carrier family 66 me... | XR_002958185.1 | 21.8% | (many diffs) | |
| 19 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | NM_025861.3 | 85.6% | 88.9% | (many diffs) |
| 20 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | XM_006526519.1 | 85.6% | 88.9% | (many diffs) |
| 21 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | XM_006526520.3 | 85.6% | 88.9% | (many diffs) |
| 22 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | NM_001164420.1 | 80.3% | 84.5% | (many diffs) |
| 23 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | NM_001164421.1 | 80.3% | 84.5% | (many diffs) |
| 24 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | NM_001164422.1 | 80.3% | 84.5% | (many diffs) |
| 25 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | XM_017317970.1 | 60.3% | 61.2% | (many diffs) |
| 26 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | XR_001782392.1 | 45.6% | (many diffs) | |
| 27 | mouse | 66943 | Pqlc1 | PQ loop repeat containing 1 | XR_386375.3 | 44% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 882
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggccgag ggcctggact ggctcctggt gccactgcac cagctggtgt 121 cctggggcgc ggccgcggcc atggtcttcg gaggggtggt gccctacgtc ccgcagtatc 181 gggacattcg caggacgcag aacgccgacg gcttctccac ctacgtgtgc ctggtgctgc 241 tggtggccaa cattttgcgg atactcttct ggtttggaag gcgctttgag tccccgctgc 301 tgtggcagag cgccatcatg atcctgacca tgctgctgat gctgaagctg tgcaccgagg 361 tccgtgtggc caacgagctc aacgccaggc gccgctcctt tacagctgca gatagcaagg 421 atgaagaagt caaggttgcc cccaggcggt ccttcctgga cttcgacccc caccacttct 481 ggcagtggag cagcttctcg gactacgtgc agtgcgtcct ggccttcacg ggcgtggcgg 541 gctacatcac ctacctgtcc attgacTCCG CCCTGTTTGT GGAGACCCTG GGCTTCCTGG 601 CTGTGCTGAC CGAAGCCATG CTGGGTGTGC CCCAGCTTTA CCGCAACCAC CGCCACCAGT 661 CCACGGAGGG CATGAGCATC AAGATGGTGC TCATGTGGAC CAGTGGTGAC GCCTTCAAGA 721 CGGCCTACTT CCTGCTGAAG GGTGCCCCTC TGCAGTTCTC CGTGTGCGGC CTGCTGCAGG 781 TGCTGGTGGA CCTGGCCATC CTGGGGCAGG CCTACGCCTT CGCCCGCCAC CCCCAGAAGC 841 CGGCGCCCCA CGCCGTGCAC CCCACTGGCA CCAAGGCCCT CTTGCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAGGT CTCTGCTCCG CCTTTGCGGC GACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t