Transcript: Human NM_001146590.2

Homo sapiens ethanolamine-phosphate phospho-lyase (ETNPPL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ETNPPL (64850)
Length:
2068
CDS:
156..1637

Additional Resources:

NCBI RefSeq record:
NM_001146590.2
NBCI Gene record:
ETNPPL (64850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034745 CCACGACAACATTGTTGAGTA pLKO.1 389 CDS 100% 4.950 6.930 N ETNPPL n/a
2 TRCN0000289819 CCACGACAACATTGTTGAGTA pLKO_005 389 CDS 100% 4.950 6.930 N ETNPPL n/a
3 TRCN0000034748 CCTATCATCCTTAATTGAGAT pLKO.1 563 CDS 100% 4.950 3.960 N ETNPPL n/a
4 TRCN0000289822 CCTATCATCCTTAATTGAGAT pLKO_005 563 CDS 100% 4.950 3.960 N ETNPPL n/a
5 TRCN0000034744 GCCAAGAGAGTAGGGAATTAT pLKO.1 1143 CDS 100% 15.000 10.500 N ETNPPL n/a
6 TRCN0000289750 GCCAAGAGAGTAGGGAATTAT pLKO_005 1143 CDS 100% 15.000 10.500 N ETNPPL n/a
7 TRCN0000034747 CCAGATGTATGGTGAAGACTT pLKO.1 923 CDS 100% 4.950 3.465 N ETNPPL n/a
8 TRCN0000034746 CGAAAGTGTGACCTCTGAGAA pLKO.1 1469 CDS 100% 4.950 3.465 N ETNPPL n/a
9 TRCN0000289820 CGAAAGTGTGACCTCTGAGAA pLKO_005 1469 CDS 100% 4.950 3.465 N ETNPPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03978 pDONR223 100% 98.7% 98.7% None 174_175insGTGGGACACTGTCACCCA n/a
2 ccsbBroad304_03978 pLX_304 0% 98.7% 98.7% V5 174_175insGTGGGACACTGTCACCCA n/a
3 TRCN0000480823 TGGGACGTTTAGTGTGGTGCTGCC pLX_317 27.6% 98.7% 98.7% V5 174_175insGTGGGACACTGTCACCCA n/a
Download CSV