Transcript: Human NM_001153690.1

Homo sapiens short coiled-coil protein (SCOC), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
SCOC (60592)
Length:
1925
CDS:
179..463

Additional Resources:

NCBI RefSeq record:
NM_001153690.1
NBCI Gene record:
SCOC (60592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001153690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134568 GAGATCCACTAATGTAGCTTA pLKO.1 1698 3UTR 100% 4.950 6.930 N SCOC n/a
2 TRCN0000133963 CAAGATGATGAATGCTGACAT pLKO.1 295 CDS 100% 4.950 3.465 N SCOC n/a
3 TRCN0000136409 CTCATGTCAGCTTCTAGTGTT pLKO.1 407 CDS 100% 4.950 3.465 N SCOC n/a
4 TRCN0000134633 GCTTCTAGATTCCATTTGGTA pLKO.1 1631 3UTR 100% 3.000 2.100 N SCOC n/a
5 TRCN0000136381 CACCAACATTTCTCTTGCAGA pLKO.1 220 CDS 100% 2.640 1.848 N SCOC n/a
6 TRCN0000135694 CTTGCAGATGACATAGACCAT pLKO.1 233 CDS 100% 2.640 1.848 N SCOC n/a
7 TRCN0000135108 CTGCAAGAGTAGATGCAGTTA pLKO.1 327 CDS 100% 0.495 0.347 N SCOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001153690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03895 pDONR223 100% 77.6% 77.6% None 141_142ins81 n/a
2 ccsbBroad304_03895 pLX_304 0% 77.6% 77.6% V5 141_142ins81 n/a
3 TRCN0000469501 TCGGTACATAACTGGCTGAATAAA pLX_317 100% 77.6% 77.6% V5 141_142ins81 n/a
Download CSV