Transcript: Human NM_001156474.2

Homo sapiens coiled-coil domain containing 81 (CCDC81), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CCDC81 (60494)
Length:
2627
CDS:
278..2236

Additional Resources:

NCBI RefSeq record:
NM_001156474.2
NBCI Gene record:
CCDC81 (60494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001156474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431502 GCTGCGCAAAGAGCGAAATTT pLKO_005 1673 CDS 100% 15.000 10.500 N CCDC81 n/a
2 TRCN0000341656 TATCCCTGGAGGGTCCATTTA pLKO_005 612 CDS 100% 13.200 9.240 N Ccdc81 n/a
3 TRCN0000428561 TGATTGTGAAACTGCGTATTT pLKO_005 2297 3UTR 100% 13.200 9.240 N CCDC81 n/a
4 TRCN0000416601 TGCAACGAGCACAACGAAATT pLKO_005 1266 CDS 100% 13.200 9.240 N CCDC81 n/a
5 TRCN0000429166 ATTTGTGAGACGGCAGTTAAC pLKO_005 388 CDS 100% 10.800 7.560 N CCDC81 n/a
6 TRCN0000137494 GAAACACGACAGTGAGATGAA pLKO.1 1180 CDS 100% 4.950 3.465 N CCDC81 n/a
7 TRCN0000137033 CAGAGATATCTCATCACCCAA pLKO.1 1030 CDS 100% 2.640 1.848 N CCDC81 n/a
8 TRCN0000136955 CCAAAGTGACAAATGTCAGCT pLKO.1 1083 CDS 100% 2.640 1.848 N CCDC81 n/a
9 TRCN0000134511 GATGGAAGAAACACAGTGTTA pLKO.1 1705 CDS 100% 4.950 2.970 N CCDC81 n/a
10 TRCN0000137829 GAGGACACAAAGAGAGCACTT pLKO.1 1954 CDS 100% 4.050 2.430 N CCDC81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001156474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08798 pDONR223 100% 86.1% 86.1% None 286_555del;1257G>A n/a
2 ccsbBroad304_08798 pLX_304 0% 86.1% 86.1% V5 286_555del;1257G>A n/a
3 TRCN0000480099 GAGCACTGAAATTCGAATTGATTC pLX_317 25.7% 86.1% 86.1% V5 286_555del;1257G>A n/a
Download CSV