Transcript: Human NM_001159279.1

Homo sapiens zinc finger protein 716 (ZNF716), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF716 (441234)
Length:
5210
CDS:
113..1600

Additional Resources:

NCBI RefSeq record:
NM_001159279.1
NBCI Gene record:
ZNF716 (441234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230989 ACAGGAGGATTTACAAGTAAA pLKO_005 469 CDS 100% 13.200 9.240 N ZNF716 n/a
2 TRCN0000218266 GCGTCAAAGTCTTTGGTAAAT pLKO_005 597 CDS 100% 13.200 9.240 N ZNF716 n/a
3 TRCN0000230990 GGAGGTTATAATTATGTTAAC pLKO_005 530 CDS 100% 10.800 7.560 N ZNF716 n/a
4 TRCN0000230992 TTACCCTCAACCTTCACTTAC pLKO_005 1283 CDS 100% 10.800 7.560 N ZNF716 n/a
5 TRCN0000230991 TACCTTCTCCTCAACTCTAAA pLKO_005 1195 CDS 100% 0.000 0.000 N ZNF716 n/a
6 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1320 CDS 100% 13.200 6.600 Y Zfp934 n/a
7 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1320 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
8 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1320 CDS 100% 13.200 6.600 Y EG668616 n/a
9 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 274 CDS 100% 4.950 2.475 Y ZNF675 n/a
10 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 244 CDS 100% 4.950 2.475 Y ZNF493 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2806 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5074 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15279 pDONR223 63.5% 77.1% 42.4% None (many diffs) n/a
Download CSV